SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


Enzyme I, general (non sugar-specific) component of the PTS
62.90 kDa
protein length
570 aa Sequence Blast
gene length
1713 bp Sequence Blast
PTS-dependent sugar transport
phosphotransferase system (PTS) enzyme I

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|General PTS proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    1,459,650 1,461,362

    Phenotypes of a mutant

  • poorly transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • Phosphoenolpyruvate protein L-histidine = pyruvate protein N(pi)-phospho-L-histidine (according to Swiss-Prot) PEP-dependent autophosphorylation on His-189, transfer of the phosphoryl group to [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]] (His-15)
  • Protein family

  • [SW|PEP-utilizing enzyme family] (according to UniProt)
  • [SW|Domains]

  • HPr binding site (N-Terminal Domain)
  • pyruvate binding site (C-Terminal Domain)
  • pyrophosphate/phosphate carrier histidine (central Domain)
  • Modification

  • transient autophosphorylation on His-189
  • ''in vivo'' also phosphorylated on Ser-34 or Ser-36 [Pubmed|17218307]
  • [SW|Cofactors]

  • Magnesium
  • Structure

  • [PDB|2WQD] (Enzyme I from ''Staphylococcus aureus'', 68% identity) [Pubmed|19801641]
  • [SW|Localization]

  • cytoplasm, even distribution [Pubmed|23475962]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11902727], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11902727], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]: antitermination, via the [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]-dependent [SW|RNA switch] [PubMed|9765562], in [regulon|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT regulon]
  • regulation

  • expression activated by glucose (2 fold) ([protein|search|GlcT]) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • available in [SW|Jörg Stülke]'s lab:
  • GP864 (Δ[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::ermC)
  • GP778 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::spc) [Pubmed|22722928]
  • BKE13910 ([gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCAATCCCTTTTAATTCTT, downstream forward: _UP4_TAATGTACAAAAACCAGACG
  • BKK13910 ([gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCAATCCCTTTTAATTCTT, downstream forward: _UP4_TAATGTACAAAAACCAGACG
  • Expression vectors

  • pAG3 (His-tag) [Pubmed|9237995], available in [SW|Galinier] lab
  • for expression, purification in ''E. coli'' (His-tag), in [SW|pWH844]: pGP813 available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • References

  • 12850135,17218307,9721285,20081037,19801641,23475962,24129255,15378759,28189581