SubtiBank SubtiBank
ptsI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ptsI

Enzyme I, general (non sugar-specific) component of the PTS
locus
BSU_13910
pI
4.59
mw
62.90 kDa
protein length
570 aa Sequence Blast
gene length
1713 bp Sequence Blast
function
PTS-dependent sugar transport
product
phosphotransferase system (PTS) enzyme I
essential
no
ec
2.7.3.9
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.1|General PTS proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    1,459,650 1,461,362

    Phenotypes of a mutant

  • poorly transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • L-histidyl-[protein] + phosphoenolpyruvate --> Nπ-phospho-L-histidyl-[protein] + pyruvate (according to UniProt)
  • PEP-dependent autophosphorylation on His-189, transfer of the phosphoryl group to [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]] (His-15)
  • Protein family

  • [SW|PEP-utilizing enzyme family] (according to UniProt)
  • [SW|Domains]

  • HPr binding site (N-Terminal Domain)
  • pyruvate binding site (C-Terminal Domain)
  • pyrophosphate/phosphate carrier histidine (central Domain)
  • Modification

  • transient autophosphorylation on His-189
  • ''in vivo'' also phosphorylated on Ser-34 or Ser-36 [Pubmed|17218307]
  • [SW|Cofactors]

  • Magnesium
  • Structure

  • [PDB|2WQD] (Enzyme I from ''Staphylococcus aureus'', 68% identity) [Pubmed|19801641]
  • [SW|Localization]

  • cytoplasm, even distribution [Pubmed|23475962]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]
    description
    [Pubmed|11902727]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11902727], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    genes
    [gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]
    description
    [Pubmed|11902727]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11902727], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]: antitermination, via the [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]-dependent [SW|RNA switch] [PubMed|9765562], in [regulon|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT regulon]
  • regulation

  • expression activated by glucose (2 fold) ([protein|search|GlcT]) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • available in [SW|Jörg Stülke]'s lab:
  • GP864 (Δ[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::ermC)
  • GP778 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::spc) [Pubmed|22722928]
  • BKE13910 ([gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCAATCCCTTTTAATTCTT, downstream forward: _UP4_TAATGTACAAAAACCAGACG
  • BKK13910 ([gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCAATCCCTTTTAATTCTT, downstream forward: _UP4_TAATGTACAAAAACCAGACG
  • GFP fusion

  • GP1268, [gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]-cfp, available in [SW|Jörg Stülke]'s lab [pubmed|23475962]
  • Expression vectors

  • pAG3 (His-tag) [Pubmed|9237995], available in [SW|Galinier] lab
  • for expression, purification in ''E. coli'' (His-tag), in [SW|pWH844]: pGP813 available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • References

  • 12850135,17218307,9721285,20081037,19801641,23475962,24129255,15378759,28189581