SubtiBank SubtiBank
ybeC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ybeC

serine transporter
locus
BSU_02120
pI
9.82
mw
59.03 kDa
protein length
539 aa Sequence Blast
gene length
1620 bp Sequence Blast
function
uptake of serine
product
serine transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.8|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.7|Utilization of alanine/ serine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    231,348 232,967

    Phenotypes of a mutant

  • resistant to serine [pubmed|32743959]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of serine [pubmed|32743959]
  • Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|YveA]
  • Structure

  • [PDB|6F2G] from Carnobacterium sp. AT7, 24.8% identity [pubmed|31000719]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP1886 Δ[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::cat, available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • GP2786 Δ[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::aphA3, available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • MGNA-B963 (ybeC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1962 NBRP B. subtilis, Japan]
  • BKE02120 ([gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
  • BKK02120 ([gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
  • GP2831 (''Δ''''[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]''::''aphA3'' ''Δ''''[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|ybeC]''::''phleo''), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP2287 (in [SW|pAC5]) (GP2965), available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • FLAG-tag construct

  • GP3062 ''ybeC-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 18763711,31000719,32743959