SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


amino acid importer
59.03 kDa
protein length
539 aa Sequence Blast
gene length
1620 bp Sequence Blast
uptake of serine
amino acid importer A

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|APC superfamily]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of alanine/ serine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    231,348 232,967

    Phenotypes of a mutant

  • resistant to serine [pubmed|32743959]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of serine [pubmed|32743959]
  • Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3AC4ED647836A1633DC3439BB4F3A74FA78CF2DB|YveA]
  • Structure

  • [PDB|6F2G] from Carnobacterium sp. AT7, 24.8% identity [pubmed|31000719]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation


    view in new tab

    Biological materials


  • GP1886 Δ[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|aimA]::cat, available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • GP2786 Δ[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|aimA]::aphA3, available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • MGNA-B963 (ybeC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02120 ([gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|aimA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
  • BKK02120 ([gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|aimA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGTAAACACCTTTCA, downstream forward: _UP4_TAAAATATAGAAGAAAACCT
  • GP2831 (''Δ''''[gene|533EEB1A454D29800C9A00A0BE107ECEE2138DAB|gltT]''::''aphA3'' ''Δ''''[gene|151A61315ADAA7213502F15C0C0ED636A4C3EA7C|aimA]''::''phleo''), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP2287 (in [SW|pAC5]) (GP2965), available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • FLAG-tag construct

  • GP3062 ''ybeC-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 18763711,31000719,32743959