SubtiBank SubtiBank
ymdB
The papers of the month are back! Check them out! Link here

ymdB

phosphodiesterase, controls bistable gene expression, required for nanotube formation
locus
BSU16970
pI
6.50
mw
29.14 kDa
protein length
264 aa Sequence Blast
gene length
792 bp Sequence Blast
function
control of bistable gene expression
product
phosphodiesterase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.4|Regulation]
  • Gene

    Coordinates
    1,768,941 → 1,769,735

    Phenotypes of a mutant

  • strong overexpression of ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' [Pubmed|21856853]
  • defective in [SW|biofilm formation] [Pubmed|21856853,22113911]
  • the phenotypes of the ''ymdB'' mutant can be suppressed by overexpression of ''[gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]'' [Pubmed|21856853]
  • inactivation of ''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]'' restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
  • increased expression of genes encoding small acid-soluble proteins [Pubmed|24163345]
  • increased intracellular levels of cyclic AMP [Pubmed|26904951]
  • abberant colony development, reduced colony size [Pubmed|26904951]
  • reduced formation of nanotubes [Pubmed|26906740]
  • inactivation of ''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]'' reduces sporulation efficiency to 11.4% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • phosphodiesterase activity toward 2',3'-cAMP [Pubmed|24163345]
  • Structure

  • [PDB|4B2O] [Pubmed|24163345]
  • Expression and Regulation

    Operons

    genes
    [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny]-[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]
    description
    [Pubmed|21856853]

    regulation

  • constitutive
  • additional information

  • the [SW|transcription] terminator between ''[SW|rny]'' and ''[SW|ymdB]'' is strong and [SW|NusA]-independent [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B070 (ymdB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1069 NBRP B. subtilis, Japan]
  • GP583 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::spc), available in [SW|Jörg Stülke]'s lab [Pubmed|21856853]
  • GP922 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::cat), available in [SW|Jörg Stülke]'s lab [Pubmed|21856853]
  • GP921 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::spc) NCIB3610 derivative, available in [SW|Jörg Stülke]'s lab [Pubmed|21856853]
  • GP969 (''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]''(E39Q)-cat) inactive enzyme, available in [SW|Jörg Stülke]'s lab [Pubmed|24163345]
  • GP1558 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::aphA3; cassette w/o terminator), available in [SW|Jörg Stülke]'s lab
  • GP1573 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::aphA3), available in [SW|Jörg Stülke]'s lab
  • GP1848 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]-[gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::''spc'' cassette), available in [SW|Jörg Stülke]'s lab
  • BKE16970 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAAATCCTTTCTT, downstream forward: _UP4_TAGTTGAACATATGGTTATT
  • BKK16970 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAAATCCTTTCTT, downstream forward: _UP4_TAGTTGAACATATGGTTATT
  • Expression vector

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP1041, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], in [SW|pGP382]: pGP1919, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1040, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP1917, available in [SW|Jörg Stülke]'s lab [Pubmed|24163345]
  • GP970 (''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]''-''Strep'' ''(cat)''), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1018 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Labs working on this gene/protein

  • [SW|Jörg Stülke], University of Göttingen, Germany
  • [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • References

    Reviews

  • 25837850,28961452
  • Original Publications

  • 21856853,22211522,22113911,24163345,26904951,26906740,26735940,28827522
  • Functional and structural analysis of orthologs in other organisms

  • 19376879,17847097