SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


phosphodiesterase, controls bistable gene expression, required for nanotube formation
29.14 kDa
protein length
264 aa Sequence Blast
gene length
792 bp Sequence Blast
control of bistable gene expression

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • Gene

    1,768,941 → 1,769,735

    Phenotypes of a mutant

  • strong overexpression of ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' [Pubmed|21856853]
  • defective in [SW|biofilm formation] [Pubmed|21856853,22113911]
  • the phenotypes of the ''ymdB'' mutant can be suppressed by overexpression of ''[gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]'' [Pubmed|21856853]
  • inactivation of ''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]'' restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
  • increased expression of genes encoding small acid-soluble proteins [Pubmed|24163345]
  • increased intracellular levels of cyclic AMP [Pubmed|26904951]
  • abberant colony development, reduced colony size [Pubmed|26904951]
  • reduced formation of nanotubes [Pubmed|26906740]
  • inactivation of ''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]'' reduces sporulation efficiency to 11.4% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • phosphodiesterase activity toward 2',3'-cAMP [Pubmed|24163345]
  • Structure

  • [PDB|4B2O] [Pubmed|24163345]
  • Expression and Regulation




  • constitutive
  • additional information

  • the [SW|transcription] terminator between ''[SW|rny]'' and ''[SW|ymdB]'' is strong and [SW|NusA]-independent [ Reference]
  • view in new tab

    Biological materials


  • MGNA-B070 (ymdB::erm), available at the [ NBRP B. subtilis, Japan]
  • GP583 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::spc), available in [SW|Jörg Stülke]'s lab [Pubmed|21856853]
  • GP922 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::cat), available in [SW|Jörg Stülke]'s lab [Pubmed|21856853]
  • GP921 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::spc) NCIB3610 derivative, available in [SW|Jörg Stülke]'s lab [Pubmed|21856853]
  • GP969 (''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]''(E39Q)-cat) inactive enzyme, available in [SW|Jörg Stülke]'s lab [Pubmed|24163345]
  • GP1558 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::aphA3; cassette w/o terminator), available in [SW|Jörg Stülke]'s lab
  • GP1573 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::aphA3), available in [SW|Jörg Stülke]'s lab
  • GP1848 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]-[gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::''spc'' cassette), available in [SW|Jörg Stülke]'s lab
  • BKE16970 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAAATCCTTTCTT, downstream forward: _UP4_TAGTTGAACATATGGTTATT
  • BKK16970 (Δ[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAAATCCTTTCTT, downstream forward: _UP4_TAGTTGAACATATGGTTATT
  • Expression vector

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP1041, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], in [SW|pGP382]: pGP1919, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1040, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP1917, available in [SW|Jörg Stülke]'s lab [Pubmed|24163345]
  • GP970 (''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]''-''Strep'' ''(cat)''), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1018 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Labs working on this gene/protein

  • [SW|Jörg Stülke], University of Göttingen, Germany
  • [ Homepage]
  • References


  • 25837850
  • Original Publications

  • 21856853,22211522,22113911,24163345,26904951,26906740,26735940,28827522
  • Functional and structural analysis of orthologs in other organisms

  • 19376879,17847097