SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


phosphodiesterase, controls bistable gene expression, required for nanotube formation
29.14 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
control of bistable gene expression

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • Gene

    1,768,941 1,769,735

    Phenotypes of a mutant

  • strong overexpression of ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' [Pubmed|21856853]
  • defective in [SW|biofilm formation] [Pubmed|21856853,22113911]
  • selective pressure for the inactivation of the [gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] gene to allow [SW|biofilm formation] [pubmed|30181249]
  • the phenotypes of the ''ymdB'' mutant can be suppressed by overexpression of ''[gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]'' [Pubmed|21856853]
  • inactivation of ''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]'' restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
  • increased expression of genes encoding small acid-soluble proteins [Pubmed|24163345]
  • increased intracellular levels of cyclic AMP [Pubmed|26904951]
  • abberant colony development, reduced colony size [Pubmed|26904951]
  • reduced formation of nanotubes [Pubmed|26906740]
  • inactivation of ''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]'' reduces sporulation efficiency to 11.4% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • phosphodiesterase activity toward 2',3'-cAMP [Pubmed|24163345]
  • nucleoside 2',3'-cyclic phosphate + H2O --> nucleoside 3'-phosphate + H+ (according to UniProt)
  • Structure

  • [PDB|4B2O] [Pubmed|24163345]
  • Expression and Regulation




  • constitutive
  • additional information

  • the [SW|transcription] terminator between ''[SW|rny]'' and ''[SW|ymdB]'' is strong and [SW|NusA]-independent [ Reference]
  • view in new tab

    Biological materials


  • MGNA-B070 (ymdB::erm), available at the [ NBRP B. subtilis, Japan]
  • GP583 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::spc), available in [SW|Jörg Stülke]'s lab [Pubmed|21856853]
  • GP922 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::cat), available in [SW|Jörg Stülke]'s lab [Pubmed|21856853]
  • GP921 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::spc) NCIB3610 derivative, available in [SW|Jörg Stülke]'s lab [Pubmed|21856853]
  • GP969 (''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]''(E39Q)-cat) inactive enzyme, available in [SW|Jörg Stülke]'s lab [Pubmed|24163345]
  • GP1558 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::aphA3; cassette w/o terminator), available in [SW|Jörg Stülke]'s lab
  • GP1573 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::aphA3), available in [SW|Jörg Stülke]'s lab
  • GP1848 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]-[gene|384D4D4C58FCBEB46B762E01478F4081FC6FAE4A|spoVS]::''spc'' cassette), available in [SW|Jörg Stülke]'s lab
  • BKE16970 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAAATCCTTTCTT, downstream forward: _UP4_TAGTTGAACATATGGTTATT
  • BKK16970 ([gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTAAATCCTTTCTT, downstream forward: _UP4_TAGTTGAACATATGGTTATT
  • Expression vectors

  • for expression/ purification from ''B. subtilis'', in [SW|pBQ200]: pGP1039, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP1041, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], in [SW|pGP382]: pGP1919, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1040, available in [SW|Jörg Stülke]'s lab
  • for expression/ purification from ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP1917, available in [SW|Jörg Stülke]'s lab [Pubmed|24163345]
  • GP970 (''[gene|154862E3FFA7CEBA5725BAD08E09D0E1C6B7F946|ymdB]''-''Strep'' ''(cat)''), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1018 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • References


  • 25837850,28961452,30218468,30482826
  • Original Publications

  • 21856853,22211522,22113911,24163345,26904951,26906740,26735940,28827522,30181249
  • Functional and structural analysis of orthologs in other organisms

  • 19376879,17847097