SubtiBank SubtiBank
kinE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

kinE

two-component sensor kinase, phosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F], part of the [SW|phosphorelay]
locus
BSU_13530
pI
5.49
mw
85.32 kDa
protein length
738 aa Sequence Blast
gene length
2217 bp Sequence Blast
function
initiation of [SW|sporulation]
product
two-component sensor kinase
essential
no
synonyms
ykrQ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.1|The kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.1|The kinases]
  • Gene

    Coordinates
    1,419,213 1,421,429

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • Paralogous protein(s)

  • [protein|4EE48E4931F662E51586DB6D01E91C688329222D|CssS], [protein|52BB660B0CAB36C74F1D47963235846B45AF78AB|YclK], [protein|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|YvrG], [protein|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|YkoH]
  • [SW|Domains]

  • two transmembrane segments
  • [SW|PAS domain]
  • C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • Expression and Regulation

    Operons

    genes
    [gene|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE]-[gene|9492D341F54BE019B21C0BAF7465AD8F84CC6F23|ogt]
    description
    [Pubmed|2506524]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2506524], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B319 (ykrQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1318 NBRP B. subtilis, Japan]
  • BKE13530 ([gene|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCATGTACACTCCTTCT, downstream forward: _UP4_GAATGAACTACTATACGACA
  • BKK13530 ([gene|1582E81F7DA85F38D6732D341ABD0F052587F25A|kinE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCATGTACACTCCTTCT, downstream forward: _UP4_GAATGAACTACTATACGACA
  • References

  • 10094672,11069677,2506524