SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


two-component response regulator ([SW|OmpR family])
26.65 kDa
protein length
231 aa Sequence Blast
gene length
693 bp Sequence Blast
two-component response regulator ([SW|OmpR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    2,704,435 → 2,705,130

    The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • Modification

  • phosphorylated by [protein|8A38FEFAA0FF91D989B77D40CBB3741902DC9D67|YrkQ] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    regulatory mechanism

  • [protein|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP]: activation, [Pubmed|18175906], in [regulon|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP regulon]
  • view in new tab

    Biological materials


  • BKE26430 (Δ[gene|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCTCTCACCTCATG, downstream forward: _UP4_CGATTTGGCGCATCTTAAAT
  • BKK26430 (Δ[gene|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCTCTCACCTCATG, downstream forward: _UP4_CGATTTGGCGCATCTTAAAT
  • References

  • 10094672,18175906,23504016