SubtiBank SubtiBank
gabP
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

gabP

gamma-amino butyric acid permease and minor proline permease
locus
BSU_06310
pI
9.45
mw
50.93 kDa
protein length
469 aa Sequence Blast
gene length
1410 bp Sequence Blast
function
utilization of gamma-amino butyric acid
product
gamma-amino butyric acid permease
essential
no
synonyms
nrg-21

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.10|Utilization of gamma-amino butyric acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    685,155 686,564

    Phenotypes of a mutant

  • defective in the utilization of gamma-amino butyrate [Pubmed|24142252]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of gamma-amino butyrate [Pubmed|24142252]
  • minor transporter for proline (allows growth with proline in the absence of the major [SW|transporters] [protein|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|PutP] and [protein|6A1F759DAC09D364602460E5467E2761E97CE45C|OpuE]) [Pubmed|24142252]
  • Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|gabP]
    description
    [Pubmed|8951816]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8951816], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|8951816], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|8951816], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|8951816]
  • view in new tab

    Biological materials

    Mutant

  • available in [SW|Erhard Bremer]'s lab [Pubmed|24142252]
  • BKE06310 ([gene|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|gabP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTTACCTCCTTTTAA, downstream forward: _UP4_TAATGCTGATCAAATCCTAA
  • BKK06310 ([gene|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|gabP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTTACCTCCTTTTAA, downstream forward: _UP4_TAATGCTGATCAAATCCTAA
  • References

  • 8951816,9677314,24142252,25755103