SubtiBank SubtiBank
immA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

immA

protease, degrades [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR] at a specific site
locus
BSU_04810
pI
8.38
mw
19.26 kDa
protein length
169 aa Sequence Blast
gene length
510 bp Sequence Blast
function
control of [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR] activity
product
site-specific protease
essential
no
synonyms
ydcM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • Gene

    Coordinates
    530,624 531,133

    Expression and Regulation

    Operons

    genes
    [gene|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|immR]-[gene|1599BBAC05EB62A847F73572CD777BC472301DE8|immA]-[gene|47AE982C5E71F31B5AF04C4F50593C2629F8EDAF|int]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE04810 ([gene|1599BBAC05EB62A847F73572CD777BC472301DE8|immA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCTTTGCTTGTATAAATTG, downstream forward: _UP4_GCTTTTGGTTAAAGGAGAAA
  • BKK04810 ([gene|1599BBAC05EB62A847F73572CD777BC472301DE8|immA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCCTTTGCTTGTATAAATTG, downstream forward: _UP4_GCTTTTGGTTAAAGGAGAAA
  • References

  • 21036995,18761623