SubtiBank SubtiBank
asnO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

asnO

asparagine synthase (glutamine-hydrolysing)
locus
BSU_10790
pI
5.70
mw
70.54 kDa
protein length
614 aa Sequence Blast
gene length
1845 bp Sequence Blast
function
biosynthesis of asparagine
product
asparagine synthase (glutamine-hydrolysing)
essential
no
ec
6.3.5.4
synonyms
yisO,yucB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.5|Biosynthesis/ acquisition of aspartate/ asparagine]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,157,237 1,159,081

    Phenotypes of a mutant

  • inactivation of ''[gene|15D150B53A25325DBC414F0C2B0D44AEF4B115A9|asnO]'' renders cells asporogenous [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + L-aspartate + L-glutamine --> AMP + diphosphate + H+ + L-asparagine + L-glutamate (according to UniProt)
  • Protein family

  • asparagine synthetase family (with [protein|6F5BBCBA02EA1C016AA37EB63D252A4C07CE6617|AsnB] and [protein|9446D9C88CBBBC5A08495D8AA49A92A9F47F2C9B|AsnH], according to UniProt)
  • [SW|Domains]

  • [SW|Glutamine amidotransferase type-2 domain] (aa 2-216) (according to UniProt)
  • Structure

  • [PDB|1CT9] (from E. coli, 27% identity) [pubmed|10587437]
  • Expression and Regulation

    Operons

    genes
    [gene|15D150B53A25325DBC414F0C2B0D44AEF4B115A9|asnO]
    description
    [Pubmed|10498721]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|10498721], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE]) [Pubmed|10498721]
  • view in new tab

    Biological materials

    Mutant

  • BKE10790 ([gene|15D150B53A25325DBC414F0C2B0D44AEF4B115A9|asnO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGACATCAGCTCCAAT, downstream forward: _UP4_TAGGTTCAATACAAATGTGA
  • BKK10790 ([gene|15D150B53A25325DBC414F0C2B0D44AEF4B115A9|asnO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGACATCAGCTCCAAT, downstream forward: _UP4_TAGGTTCAATACAAATGTGA
  • References

    Reviews

  • 12859215,11395405
  • Original publications

  • 10498721,15383836,26735940,10587437