SubtiBank SubtiBank
yfiR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfiR

transcriptional regulator ([SW|TetR family]) of the [gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]-[gene|search|yfiR ]operon
locus
BSU_08370
pI
5.02
mw
23.54 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
function
control of [gene|search|yfiS ]expression
product
transcriptional regulator ([SW|TetR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    911,964 912,581

    The protein

    Protein family

  • [SW|TetR family]
  • Structure

  • [PDB|1RKT] [Pubmed|16862575]
  • Expression and Regulation

    Operons

    genes
    [gene|09D56215645F3E13803704F96FC6AD3FAAD58EF4|yfiS]-[gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yfiSR.html DBTBS]) null

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|15DE8BAFB36296B5842E283C836D600755786397|YfiR]: repression, [pubmed|], in [regulon|15DE8BAFB36296B5842E283C836D600755786397|YfiR regulon]
  • view in new tab

    genes
    [gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C356 (yfiR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2354 NBRP B. subtilis, Japan]
  • BKE08370 ([gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTATCCTTGTGCTCCTTT, downstream forward: _UP4_TAAAGAAACGCGGCAGGAGC
  • BKK08370 ([gene|15DE8BAFB36296B5842E283C836D600755786397|yfiR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTTATCCTTGTGCTCCTTT, downstream forward: _UP4_TAAAGAAACGCGGCAGGAGC
  • References

    Reviews

  • 24006471
  • Original publications

  • 25755103,16862575,22383849