SubtiBank SubtiBank
ktrC

ktrC

low affinity potassium channel [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|KtrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|KtrD], peripheric membrane component
locus
BSU_14510
pI
5.63
mw
24.20 kDa
protein length
221 aa Sequence Blast
gene length
666 bp Sequence Blast
function
potassium uptake
product
low affinity potassium channel [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|KtrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|KtrD], peripheric membrane component
essential
no
synonyms
ylxV,yzaC,ykqB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.3|Potassium uptake/ export]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.1|Targets of c-di-AMP]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,520,531 1,521,196

    The protein

    Protein family

  • KtrA potassium transport family (with [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA], according to UniProt)
  • Paralogous protein(s)

  • [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]
  • Kinetic information

  • the [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|KtrC]-[protein|search|KtrD ]channel has a low affinity for potassium,this is determined by [protein|A0952B75E5BD0D09B0F4C257822428640998558B|KtrD] [pubmed|30753894]
  • [SW|Domains]

  • contains a [SW|RCK_N domain] at the N-terminus (aa 4-126)(according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])
  • contains a c-di-AMP-binding [SW|RCK_C domain] at the C-terminus (aa 135-219) (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt]) [Pubmed|23671116]
  • Effectors of protein activity

  • binds ADP and ATP [pubmed|30753894]
  • the protein binds c-di-AMP, KD = 30 nM, this results in inhibition of potassium uptake [Pubmed|30753894]
  • Structure

  • [PDB|4J7C] (the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB] complex, 56% identity) [Pubmed|23598340]
  • [PDB|6I8V] ([protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|KtrC] in complex with ATP) [Pubmed|30753894]
  • [PDB|4XTT] (the ''S. aureus'' [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA] [SW|RCK_C domain] in complex with c-di-AMP, 57% identity) [Pubmed|25957408]
  • [SW|Localization]

  • peripheral membrane protein [Pubmed|12562800]
  • Expression and Regulation

    Operons

    genes
    [gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]
    description
    [Pubmed|12562800]

    regulation

  • constitutively expressed [Pubmed|12562800]
  • view in new tab

    genes
    [gene|A656321846B2E0D1F39B528E2D8B8E620CCD1148|kinC]-[gene|22DBF4D1F93519A95E6BCC0FB1AC2387DF444E27|ykqA]-[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8002614], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|8002615], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • constitutively expressed [Pubmed|12562800]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A904 (ykqB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/904 NBRP B. subtilis, Japan]
  • GHB6 ([gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''spec''), [Pubmed|12562800] (available in [SW|Erhard Bremer]'s and [SW|Jörg Stülke]'s) labs, available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A955&Search=1A955 BGSC] as 1A955
  • GP2264 (''Δ''''[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]''::''aphA3''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • GP2048 (''Δ''''[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]''::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • GP2079 (''Δ''''[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]''::''tet''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • GP2771 (''Δ''''[gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]''::''spec''), available in [SW|Jörg Stülke]'s lab
  • GP2083 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3'' [gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''tet''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • BKE14510 ([gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC
  • BKK14510 ([gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC
  • Expression vector

  • pGP2994: expression of Strep-KtrC in B. subtilis suitable for [SW|SPINE] (based on [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • pGP2995: expression of KtrC-Strep in B. subtilis suitable for [SW|SPINE] (based on [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
  • Expression vectors

  • pGP2907 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
  • References

    Reviews

  • 25869574,27935846,25838295,31361596
  • Original publications

  • 12562800,23671116,23598340,28420751,28504641,30753894,31061098,31506295