SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


malic enzyme
45.73 kDa
protein length
439 aa Sequence Blast
gene length
1317 bp Sequence Blast
malate utilization
NAD-dependent malate dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • Gene

    2,451,463 → 2,452,782

    The protein

    Catalyzed reaction/ biological activity

  • (S)-malate + NAD+ = pyruvate + CO2 + NADH (according to Swiss-Prot) malate -→ pyruvate
  • Protein family

  • malic enzymes family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|YtsJ], [protein|BBBCD5F56779895189E21076AF165B901F654534|MalS]
  • [SW|Domains]

  • [SW|ACT domain] (aa 9 ... 84) (according to the Interpro database)
  • Structure

  • [PDB|2A9F] (from Streptococcus pneumoniae, 42% identity from aa 90 - 435)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1711029], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|146947C974D62BCB282BA3F5B924B35695D75886|AnsR]: repression, [Pubmed|11914346], in [regulon|146947C974D62BCB282BA3F5B924B35695D75886|AnsR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • ''[protein|search|ansA]'': expressed in the presence of asparagine ([protein|search|AnsR]) [Pubmed|11914346]
  • view in new tab



  • ''[protein|search|ansA]'': expressed in the presence of asparagine ([protein|search|AnsR]) [Pubmed|11914346]
  • view in new tab

    Biological materials


  • MGNA-C412 (yqkJ::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1136 (cat) available in [SW|Stülke] lab
  • BKE23550 (Δ[gene|160EBB7885D7C7FD30A6E35605A862C156E2DA80|mleA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATTCAGTGATCCTCCC, downstream forward: _UP4_TAAATGTAGCTAAACAGCAC
  • BKK23550 (Δ[gene|160EBB7885D7C7FD30A6E35605A862C156E2DA80|mleA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATTCAGTGATCCTCCC, downstream forward: _UP4_TAAATGTAGCTAAACAGCAC
  • References

  • 16788182,11914346,22383849,23136871