SubtiBank SubtiBank
ykzB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ykzB

unknown
locus
BSU_13320
pI
4.56
mw
5.80 kDa
protein length
gene length
156 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,397,938 1,398,093

    Expression and Regulation

    Operons

    genes
    [gene|1645EA183E9BCF20658620D96439E93F96862380|ykzB]-[gene|5C10AAF15872DDC1B5A8062124739CB06AD3C112|ykoL]
    description
    [Pubmed|10671441]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10671441], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|10671441], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|10671441], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • ''[protein|search|ykoL]'': induced by phosphate limitation ([protein|search|PhoP]) [Pubmed|10671441]
  • view in new tab

    Biological materials

    Mutant

  • BKE13320 ([gene|1645EA183E9BCF20658620D96439E93F96862380|ykzB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTATCCTTCCTCCTC, downstream forward: _UP4_TAAACATAAATTCTTTACAT
  • BKK13320 ([gene|1645EA183E9BCF20658620D96439E93F96862380|ykzB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTATCCTTCCTCCTC, downstream forward: _UP4_TAAACATAAATTCTTTACAT
  • References

  • 10671441,25755103