SubtiBank SubtiBank
ytoP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytoP

similar to glutamyl aminopeptidase
locus
BSU_29860
pI
5.65
mw
39.08 kDa
protein length
357 aa Sequence Blast
gene length
1074 bp Sequence Blast
function
unknown
product
putative glutamyl aminopeptidase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,055,247 3,056,320

    The protein

    Protein family

  • Peptidase M42 family (with [protein|D6F5F7C1C699C674FA7AC09A020E8E2F571E1AA9|YsdC] and [protein|EDD5ACB89661D3B6D77057863EF345EBF84F49B2|YhfE], according to UniProt)
  • Paralogous protein(s)

  • [protein|D6F5F7C1C699C674FA7AC09A020E8E2F571E1AA9|YsdC]
  • Structure

  • [PDB|3KL9] (PepA from Streptococcus pneumoniae, 44% identity) [pubmed|19914209]
  • Expression and Regulation

    Operons

    genes
    [gene|16585F4118F3D2732D6780D351B7AA5F6DDCCEB8|ytoP]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A436 (ytoP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/436 NBRP B. subtilis, Japan]
  • BKE29860 ([gene|16585F4118F3D2732D6780D351B7AA5F6DDCCEB8|ytoP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCCCCTCATTTCT, downstream forward: _UP4_TAGGTTTCATAAAAGCTTGT
  • BKK29860 ([gene|16585F4118F3D2732D6780D351B7AA5F6DDCCEB8|ytoP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCCCCTCATTTCT, downstream forward: _UP4_TAGGTTTCATAAAAGCTTGT
  • References

    Research papers

  • 19914209