SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


N-acetyl muramic acid permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIBC of the [category|SW 1.2.2|PTS]
47.44 kDa
protein length
455 aa Sequence Blast
gene length
1368 bp Sequence Blast
N-acetyl muramic acid uptake and phosphorylation
N-acetyl muramic acid [category|SW 1.2.2|PTS] permease, EIIBC component

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Utilization of cell wall components]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of amino sugars]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • Gene

    189,790 191,157

    The protein

    Catalyzed reaction/ biological activity

  • transport and concomitant phosphorylation of N-acetyl muramic acid
  • Protein family

  • [category|SW 1.2.2|PTS] permease, sucrose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|BglP], [protein|531F132F7F6A878F1E1D56977B9898A14272349A|SacX], [protein|AE02C38397AA790E4B216BB6DBABFE907B984D05|SacP], [protein|BC568649A341B2E6341993EDA4BF52BDE18A3294|TreP]
  • Expression and Regulation



    regulatory mechanism

  • [protein|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR]: repression, [pubmed|30038046], in [regulon|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR regulon]
  • regulation

  • expressed in late exponential and early stationary phase [Pubmed|20400549]
  • view in new tab

    Biological materials


  • MGNA-B950 (ybbF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE01680 ([gene|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|murP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACCCCTCCCCTTC, downstream forward: _UP4_TAAATTGTTTCTGTTTTAGG
  • BKK01680 ([gene|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|murP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAACCCCTCCCCTTC, downstream forward: _UP4_TAAATTGTTTCTGTTTTAGG
  • References

  • 10627040,15060041,22383849,30038046