SubtiBank SubtiBank
yacL
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yacL

general stress protein, survival of salt and ethanol stresses
locus
BSU_00890
pI
4.97
mw
40.70 kDa
protein length
366 aa Sequence Blast
gene length
1101 bp Sequence Blast
function
survival of salt and ethanol stresses
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    108,674 109,774

    The protein

    Protein family

  • Ycf81 family (single member, according to UniProt)
  • [SW|Domains]

  • PINc domain (aa 169-280) ( according to UniProt)
  • [SW|TRAM domain] (aa 295-356) (according to UniProt)
  • Structure

  • [PDB|3IX7] (from Thermus thermophilus, corresponds to aa 168 ... 294, 45% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|179FDEA51A060DF32A3EA06A796793DE27B600FF|yacL]-[gene|CF9633F769263C6D16EE778F6BD2ECF1995F512A|ispD]-[gene|1A6793A3A5AC568C67873C8708E9F581F42AB9BA|ispF]
    description
    [Pubmed|10482513]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B933 (yacL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1932 NBRP B. subtilis, Japan]
  • BKE00890 ([gene|179FDEA51A060DF32A3EA06A796793DE27B600FF|yacL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCCCACCTCCTTTTT, downstream forward: _UP4_GCGCTGTAAAGGGAGAAGAA
  • BKK00890 ([gene|179FDEA51A060DF32A3EA06A796793DE27B600FF|yacL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCCCACCTCCTTTTT, downstream forward: _UP4_GCGCTGTAAAGGGAGAAGAA
  • References

  • 15805528,10482513,17434969