SubtiBank SubtiBank
iolQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

iolQ

transcriptional repressor of [gene|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX] expression, transcriptional activator involved in the degradation of glutamine phosphoribosylpyrophosphate amidotransferase
locus
BSU_10840
pI
5.78
mw
36.44 kDa
protein length
337 aa Sequence Blast
gene length
1014 bp Sequence Blast
function
control of scyllo-inositol utilization
product
transcription factor ([SW|LacI family])
essential
no
synonyms
degA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    1,163,148 1,164,161

    The protein

    Catalyzed reaction/ biological activity

  • binds to [gene|AA7DCEFB17FD6F9C4F65235E9A247A6EC2242B06|iolX] promoter region [pubmed|28693424]
  • Structure

  • [PDB|2HSG] ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA], 35% identity) [pubmed|17500051]
  • Expression and Regulation

    Operons

    genes
    [gene|5B173B400D0B4C150E94A98D35E27B0B4358489B|yisR]-[gene|17F5188958A415D8D09439E02E1D1E0661B5C760|iolQ]
    description
    [pubmed|22383849]
    view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • BKE10840 ([gene|17F5188958A415D8D09439E02E1D1E0661B5C760|iolQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGTTCATCCCTCGTC, downstream forward: _UP4_TGAGCCCGCTAATGAGCGGG
  • BKK10840 ([gene|17F5188958A415D8D09439E02E1D1E0661B5C760|iolQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGTTCATCCCTCGTC, downstream forward: _UP4_TGAGCCCGCTAATGAGCGGG
  • References

  • 8407808,12884008,28693424