SubtiBank SubtiBank
yoaC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yoaC

similar to xylulokinase
locus
BSU_18550
pI
4.86
mw
53.94 kDa
protein length
487 aa Sequence Blast
gene length
1464 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,022,561 2,024,024

    The protein

    Protein family

  • [SW|FGGY kinase family] (according to UniProt)
  • Structure

  • [PDB|2W41] (glycerol kinase from Plasmodium falciparum, 25% identity) [pubmed|19040641]
  • Expression and Regulation

    Operons

    genes
    [gene|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|yoaD]-[gene|182B8EFA41DAE695B008CBAA561F3730D11750B1|yoaC]-[gene|FF60633F2902E4CA58B34FF3DAFF85B0D4007622|yoaB]
    description
    [Pubmed|10094622]

    regulatory mechanism

  • [regulon|S-box|S-box]: termination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|S-box|S-box]
  • regulation

  • induced by methionine starvation ([SW|S-box]) [Pubmed|10094622]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A834 (yoaC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/834 NBRP B. subtilis, Japan]
  • BKE18550 ([gene|182B8EFA41DAE695B008CBAA561F3730D11750B1|yoaC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATTCTGTTAGCCTCCT, downstream forward: _UP4_TAAGACGGAATTTCTGCTGT
  • BKK18550 ([gene|182B8EFA41DAE695B008CBAA561F3730D11750B1|yoaC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATTCTGTTAGCCTCCT, downstream forward: _UP4_TAAGACGGAATTTCTGCTGT
  • References

  • 12107147,18039762,19040641