SubtiBank SubtiBank
yckA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yckA

similar to amino acid [SW|ABC transporter] (permease)
locus
BSU_03370
pI
9.43
mw
25.08 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    367,305 367,985

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|9400DF25487461E3738DDDC72BDDB1589281409D|TcyB], [protein|FFD5F07480A0E5A74852C69C436EE289BA72FC7F|YxeN]
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 27-215) (according to UniProt)
  • Structure

  • [PDB|4YMS] (amino acid transporter from Caldanaerobacter subterraneus, 35% identity) [pubmed|25848002]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|yckB]-[gene|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|yckA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C001 (yckA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1999 NBRP B. subtilis, Japan]
  • BKE03370 ([gene|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|yckA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGCTATTGATCATGGCGT, downstream forward: _UP4_TAAACAAACGTTTCATTAAA
  • BKK03370 ([gene|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|yckA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGCTATTGATCATGGCGT, downstream forward: _UP4_TAAACAAACGTTTCATTAAA
  • References

  • 10092453,25848002