SubtiBank SubtiBank
bshA
The papers of the month are back! Check them out! Link here

bshA

L-malic acid glycosyltransferase, involved in bacillithiol synthesis
locus
BSU22460
pI
6.15
mw
41.82 kDa
protein length
377 aa Sequence Blast
gene length
1131 bp Sequence Blast
function
biosynthesis of bacillithiol
product
L-malic acid glycosyltransferase
essential
no
synonyms
jojH,ypjH

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.2|Biosynthesis of bacillithiol]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,357,078 → 2,358,211

    Phenotypes of a mutant

  • impaired growth in minimal medium, reduced activity of enzymes containing FeS cluster [Pubmed|25988368]
  • sensitivity to superoxide (paraquate) stress [Pubmed|25988368]
  • The protein

    Catalyzed reaction/ biological activity

  • UDP-GlcNAc L-malate = GlcNAc(α1→2)L-malate UDP [Pubmed|20308541]; also uses D-malate as a substrate, but with much lower affinity [Pubmed|20308541]
  • Protein family

  • NamA subfamily (according to Swiss-Prot)
  • Effectors of protein activity

  • subject to feedback inhibition by bacillithiol [Pubmed|22569254]
  • Structure

  • [PDB|5D00] [Pubmed|27454321]
  • Expression and Regulation

    Operons

    genes
    [gene|A828298EA2A002538876FBA6113648AAD9C4C317|ypjD]-[gene|5AB90032031653A913E15B26B3E1AE246E95AABF|dapB]-[gene|341F198B2BD4261B20C00181D084A7C5E33E39B3|mgsA]-[gene|60367F0396612C8A6491FD92A73B30BED7215506|bshB1]-[gene|187C78441816FC74B0FCCE34997E8AEC0A80B114|bshA]-[gene|4C4FA59FF5D100E941EF470C0C54E85681ADC74F|cca]-[gene|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|birA]
    description
    [Pubmed|20308541]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23894131], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|23894131], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by diamide stess (thiol depletion) ([protein|search|Spx]) [Pubmed|23894131]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A410 (ypjH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/410 NBRP B. subtilis, Japan]
  • ''bshA::mls'' available in [SW|John_Helmann] lab
  • GP88 (''bshA''::''pX2''(''cat'')), available in [SW|Jörg Stülke]'s lab
  • BKE22460 (Δ[gene|187C78441816FC74B0FCCE34997E8AEC0A80B114|bshA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATTGTTCGCCCCCAAG, downstream forward: _UP4_GATTTAGCAGAACCGGAGTG
  • BKK22460 (Δ[gene|187C78441816FC74B0FCCE34997E8AEC0A80B114|bshA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATTGTTCGCCCCCAAG, downstream forward: _UP4_GATTTAGCAGAACCGGAGTG
  • References

    Reviews

  • 28117687
  • Original Publications

  • 20308541,19578333,22569254,20799687,23894131,25988368,27454321