SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


activator of [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB], control of the [SW|phosphorelay]
14.53 kDa
protein length
128 aa Sequence Blast
gene length
387 bp Sequence Blast
control of [SW|sporulation] initiation
activator of [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB] in the initiation of [SW|sporulation]

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Proteins controlling the activity of the kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Proteins controlling the activity of the kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,231,399 3,231,785

    The protein


  • [PDB|1Y71] (from B. cereus, 61% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8497199], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [regulon|stringent response|stringent response]: positive regulation, [Pubmed|23378509], in [regulon|stringent response|stringent response]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [pubmed|29321771], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • induced upon addition of decoyinine (positive [SW|stringent response]) [Pubmed|23378509]
  • view in new tab

    Biological materials


  • BKE31460 ([gene|18867F99B039D20DBCF004BC72E35CF0AE8FE467|kapB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCATCACCTCGCAT, downstream forward: _UP4_TAACCCAGTCTGACAAAAGA
  • BKK31460 ([gene|18867F99B039D20DBCF004BC72E35CF0AE8FE467|kapB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCATCACCTCGCAT, downstream forward: _UP4_TAACCCAGTCTGACAAAAGA
  • References

  • 9426145,12618455,8497199,7592498,29314743