SubtiBank SubtiBank
lplD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lplD

alpha-galacturonidase
locus
BSU_07130
pI
5.36
mw
49.32 kDa
protein length
446 aa Sequence Blast
gene length
1341 bp Sequence Blast
function
utilization of pectin
product
alpha-galacturonidase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    782,958 784,298

    The protein

    Catalyzed reaction/ biological activity

  • cleavage of alpha-1,4-di-galacturonate [Pubmed|23416295]
  • [(1→4)-α-D-galacturonosyl](n) + H2O --> [(1→4)-α-D-galacturonosyl](n-1) + α-D-galacturonate (according to UniProt)
  • Protein family

  • [SW|Glycosyl hydrolase 4 family] (according to UniProt)
  • [SW|Domains]

  • active site motif: CHEV [Pubmed|23416295]
  • [SW|Cofactors]

  • NAD, Mn(2+) [Pubmed|23416295]
  • Structure

  • [PDB|3FEF]
  • Expression and Regulation

    Operons

    genes
    [gene|18B09A645AC8E13A1AD3B73A0C828E5A0F5D42BB|lplD]-[gene|EBD0F966FD7B3662814D530064BD307561A5CB15|yetF]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|26577401], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE07130 ([gene|18B09A645AC8E13A1AD3B73A0C828E5A0F5D42BB|lplD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTGATATGAAACACTCCCT, downstream forward: _UP4_TGAGCTTGCCGATTAGCTCT
  • BKK07130 ([gene|18B09A645AC8E13A1AD3B73A0C828E5A0F5D42BB|lplD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTGATATGAAACACTCCCT, downstream forward: _UP4_TGAGCTTGCCGATTAGCTCT
  • References

  • 23416295