SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional regulator (repressor or activator) of a subset of [protein|search|SigK]-dependent late spore coat genes
8.43 kDa
protein length
gene length
222 bp Sequence Blast
regulation of [protein|search|SigK]-dependent gene expression
transcriptional regulator (LuxR-FixJ family)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • Gene

    2,904,727 → 2,904,951

    Phenotypes of a mutant

  • unable to germinate efficiently [Pubmed|3139490]
  • The protein

    Protein family

  • LuxR-FixJ family of transcription regulators
  • Structure

  • [PDB|1FSE]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN]: sigma factor, [Pubmed|15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigKN regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|7896717], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB]: mRNA binding, results in mRNA accumulation [Pubmed|16923907], in [regulon|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [SW|SpoIIID]) [Pubmed|15699190,7896717]
  • view in new tab

    Biological materials


  • BKE28410 (Δ[gene|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTATTGTAACCCTCCTT, downstream forward: _UP4_TAATCCTTGCCGGTATTCCT
  • BKK28410 (Δ[gene|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTATTGTAACCCTCCTT, downstream forward: _UP4_TAATCCTTGCCGGTATTCCT
  • Labs working on this gene/protein

  • [SW|Arthur Aronson], Purdue University, West Lafayette, USA [ homepage]
  • [SW|Charles Moran], Emory University, NC, USA [ homepage]
  • References

  • 7519271,2474075,11418558,10400595,7592393,11741866,7592342,3135411,9852018,1691789,15383836,11150673,1518043,7814326,14523132,12031481,11418558,3114423,7896717,11243786,17890309,15470121,20435725,21670523,23064347,3139490,25259857,6787012,26279233,16923907