SubtiBank SubtiBank
ysdA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ysdA

unknown
locus
BSU_28840
pI
9.96
mw
10.18 kDa
protein length
gene length
270 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,951,898 2,952,167

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]-[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]-[gene|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]-[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]
    description
    [Pubmed|17289755]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|RplT]: termination, via binding to a [SW|RNA switch] in the [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC] leader region causes transcription termination, in [regulon|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|RplT regulon]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • additional information

  • autorepression of [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]-[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]-[gene|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]-[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA] expression upon binding of excess [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|RplT] to the untranslated region of the mRNA [Pubmed|29925569,17616982]
  • expression of [protein|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|IF3 ]is uncoupled from that of [protein|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|L35 ]and [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|L20 ]by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent mRNA processing [PubMed|21843271]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • GP2391 ∆''[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]''::''kan'', available in [SW|Jörg Stülke]'s lab
  • MGNA-B024 (ysdA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1023 NBRP B. subtilis, Japan]
  • BKE28840 ([gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGCCTCATCCTTTAT, downstream forward: _UP4_GATTTATAAAAAGCAGAAAA
  • BKK28840 ([gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGCCTCATCCTTTAT, downstream forward: _UP4_GATTTATAAAAAGCAGAAAA
  • References

  • 17289755,29925569