SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


10.18 kDa
protein length
gene length
270 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,951,898 2,952,167

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|RplT]: termination, via binding to a [SW|RNA switch] in the [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC] leader region causes transcription termination, in [regulon|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|RplT regulon]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • additional information

  • autorepression of [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]-[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]-[gene|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]-[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA] expression upon binding of excess [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|RplT] to the untranslated region of the mRNA [Pubmed|29925569,17616982]
  • expression of [protein|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|IF3 ]is uncoupled from that of [protein|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|L35 ]and [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|L20 ]by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent mRNA processing [PubMed|21843271]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • GP2391 ∆''[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]''::''kan'', available in [SW|Jörg Stülke]'s lab
  • MGNA-B024 (ysdA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28840 ([gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGCCTCATCCTTTAT, downstream forward: _UP4_GATTTATAAAAAGCAGAAAA
  • BKK28840 ([gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTGCCTCATCCTTTAT, downstream forward: _UP4_GATTTATAAAAAGCAGAAAA
  • References

  • 17289755,29925569