SubtiBank SubtiBank
tyrZ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

tyrZ

alternative tyrosyl-tRNA synthetase, required to prevent misincorporation of D-Tyr into proteins
locus
BSU_38460
pI
6.66
mw
46.94 kDa
protein length
413 aa Sequence Blast
gene length
1242 bp Sequence Blast
function
translation
product
tyrosyl-tRNA synthetase (minor)
essential
no
ec
6.1.1.1
synonyms
ipa-9r,tyrS1,tyrT

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.10|Aminoacyl-tRNA synthetases]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    3,947,158 3,948,399

    Phenotypes of a mutant

  • sensitive against D-Tyr [Pubmed|25733610]
  • a ''[gene|EEB0CF0AF0707AC1161F150708F7EDDB749B3C42|tyrS] [gene|1968743631A20739B5DA8B489CB1E7E42F3B93E3|tyrZ]'' double mutant is not viable [Pubmed|25733610]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + L-tyrosine + tRNATyr --> AMP + diphosphate + H+ + L-tyrosyl-tRNATyr (according to UniProt)
  • [protein|1968743631A20739B5DA8B489CB1E7E42F3B93E3|TyrZ] is highly specific for L-Tyr, prevents misincorporation of D-Tyr into proteins, less processive than [protein|EEB0CF0AF0707AC1161F150708F7EDDB749B3C42|TyrS] [Pubmed|25733610]
  • Protein family

  • [SW|S4 RNA-binding domain] superfamily (according to http://www.ebi.ac.uk/interpro/entry/IPR036986 Interpro)
  • [SW|Class-I aminoacyl-tRNA synthetase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EEB0CF0AF0707AC1161F150708F7EDDB749B3C42|TyrS]
  • [SW|Domains]

  • [SW|S4 RNA-binding domain] (aa 353-413) (according to UniProt)
  • Modification

  • phosphorylated on Thr-311 [Pubmed|20509597]
  • Structure

  • [PDB|6BQY] (from Acinetobacter baumannii, 46% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|dtrR]-[gene|1968743631A20739B5DA8B489CB1E7E42F3B93E3|tyrZ]
    description
    [Pubmed|25733610]

    sigma factors

  • [protein|1968743631A20739B5DA8B489CB1E7E42F3B93E3|TyrZ]: sigma factor, [Pubmed|1735721], in [regulon|1968743631A20739B5DA8B489CB1E7E42F3B93E3|TyrZ regulon]
  • regulatory mechanism

  • [protein|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|DtrR]: repression, [Pubmed|25733610], in [regulon|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|DtrR regulon]
  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • regulation

  • induced by tyrosine limitation ([protein|search|T-box]) [Pubmed|25733610,19258532,1735721]
  • view in new tab

    Biological materials

    Mutant

  • QB53532 (aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE38460 ([gene|1968743631A20739B5DA8B489CB1E7E42F3B93E3|tyrZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCTCCTTTTTTAC, downstream forward: _UP4_TAATCTGATATTCCGAAACG
  • BKK38460 ([gene|1968743631A20739B5DA8B489CB1E7E42F3B93E3|tyrZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTCCTCCTTTTTTAC, downstream forward: _UP4_TAATCTGATATTCCGAAACG
  • References

    Reviews

  • 19258532,10546897
  • Original publications

  • 1735721,25733610,20509597