SubtiBank SubtiBank
pelB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pelB

pectate lyase
locus
BSU_18650
pI
9.44
mw
37.95 kDa
protein length
345 aa Sequence Blast
gene length
1038 bp Sequence Blast
function
degradation of polygalacturonic acid
product
pectate lyase
essential
no
ec
4.2.2.10
synonyms
ppr

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,034,745 2,035,782

    The protein

    Catalyzed reaction/ biological activity

  • Eliminative cleavage of (1->4)-alpha-D-galacturonan methyl ester to give oligosaccharides with 4-deoxy-6-O-methyl-alpha-D-galact-4-enuronosyl groups at their non-reducing ends (according to UniProt)
  • Protein family

  • [SW|lyase 1 family] (according to UniProt)
  • Structure

  • [PDB|3VMV] (from Bacillus sp. N165, 29% identity) [pubmed|22414692]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Biological materials

    Mutant

  • BKE18650 ([gene|19854503A5A0A19E72C8E1BEC65EECC243E96F79|pelB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACAATATGCTTCCTTT, downstream forward: _UP4_TGATATAAAAGAGGCCCTGC
  • BKK18650 ([gene|19854503A5A0A19E72C8E1BEC65EECC243E96F79|pelB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACAATATGCTTCCTTT, downstream forward: _UP4_TGATATAAAAGAGGCCCTGC
  • References

  • 18957862,22414692