SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


WhiA family protein, involved in Z ring assembly, required for normal chromosome segregation
36.18 kDa
protein length
316 aa Sequence Blast
gene length
951 bp Sequence Blast
control of Z ring asembly and chromosome segregation
[category|SW 1.1.8|Cell division] protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW|Other genes]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.3|DNA condensation/ segregation]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    3,569,573 3,570,523

    Phenotypes of a mutant

  • a [gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA] double mutant grows poorly, and the cells are filamentous (due to a defect in Z ring assembly) [Pubmed|24097947]
  • a [gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|B317D7E51824DD70EF84E4D5D7290D601BF4FAB6|ezrA] double mutant grows poorly, and the cells are filamentous [Pubmed|24097947]
  • a [gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|8C94C9598A823A8405B3E1FA0124E21D90845B8E|minC]-[gene|37DAD42A391E2FC506225EAF91B8F21629A401DF|minD] mutant grows poorly, and the cells are filamentous [Pubmed|24097947]
  • a [gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|559DEDC9887B811EF80994526256ADC48BA51CE3|noc] double mutant grows poorly, and the cells are filamentous [Pubmed|24097947]
  • a [gene|search|whiA ][gene|search|parB ]double mutant is not viable, this can be suppressed by inactivation of [gene|search|yneA ][pubmed|29378890]
  • a [gene|search|whiA ][gene|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA] double mutant is not viable [pubmed|29378890]
  • the defects of the ''[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]'' double mutant can be suppressed by inactivation of either ''[gene|D368988F85D8436DD424B0B4A1591BDF092A8EA7|gtaB]'', ''[gene|70412A747D1ED3E885126945DF02503667C13E5B|pgcA]'', or ''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]'' [Pubmed|24097947]
  • highly sensitive for DNA damaging agents [pubmed|29378890]
  • The protein

    Protein family

  • WhiA family (single member, according to UniProt) [Pubmed|10986251]
  • [SW|Domains]

  • suggested HTH domain at the N terminus [Pubmed|19836336]
  • Structure

  • [PDB|3HYI] (Crystal structure of full-length DUF199/WhiA from ''Thermotoga maritima'')
  • [PDB|3HYJ] (Crystal structure of the N-terminal LAGLIDADG domain of DUF199/WhiA)
  • [SW|Localization]

  • localizes to the nucleoid [Pubmed|24097947]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16272399], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • MGNA-B639 (yvcL::erm), available at the [ NBRP B. subtilis, Japan]
  • GP231 (''amyE::P[gene|751D0B909922D4D931FF3B2285CF142D966FCD48|rpsJ]-lacZ, [gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA]::cat'') available in [SW| Jörg Stülke]'s lab; plasmid pGP1468 was used to disrupt the gene.
  • BKE34750 (Δ[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAGCCACCTCATTTCA, downstream forward: _UP4_TAACCGTAAAGAAAAGGGGA
  • BKK34750 (Δ[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAGCCACCTCATTTCA, downstream forward: _UP4_TAACCGTAAAGAAAAGGGGA
  • Expression vectors

  • pGP1469 for expression in ''B. subtilis'' (in [SW|pGP382], with C-terminal STREP-TAG), available in [SW| Jörg Stülke]'s lab
  • pGP2429 (N-terminal Strep-Tag, purification from ''E. coli'' and/or ''B. subtilis'', in pDG148), for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • pGP2430 (C-terminal Strep-Tag, purification from ''E. coli'' and/or ''B. subtilis'', in pDG148), for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW| Jörg Stülke]'s and [SW|Boris Görke]'s labs
  • FLAG-tag construct

  • GP782 (''spc'', based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Leendert Hamoen]'s lab [Pubmed|24097947]
  • References

  • 9237995,16272399,10986251,19836336,17603302,24097947,29378890