SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


lipoprotein, part of guanosine transporter
37.19 kDa
protein length
359 aa Sequence Blast
gene length
1080 bp Sequence Blast
uptake of guanosine
lipoprotein, part of guanosine transporter

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,239,930 3,241,009

    Phenotypes of a mutant

  • a ''[gene|19BA45BD691BBA4B23C4741C63DB729AA5D30FDA|nupN] [gene|C333F405F597FF260FFA0EC616B8CF6BF454815B|nupG]'' double mutant is unable to utilize externally provided guanosine [Pubmed|21926227]
  • The protein

    Protein family

  • BMP lipoprotein family (with [protein|4DAB7847EA3848A34432C80124464543FA3DCA0F|Med], according to UniProt)
  • Structure

  • [PDB|2FQW] (from Treponema pallidum, 45% identity) [pubmed|16418175]
  • [SW|Localization]

  • cell membrane (according to UniProt), membrane associated [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21926227], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455,21699902,21926227], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455,21699902,21926227]
  • view in new tab

    Biological materials


  • MGNA-B553 (yufN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE31540 ([gene|19BA45BD691BBA4B23C4741C63DB729AA5D30FDA|nupN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATATAACCCCCCAGAA, downstream forward: _UP4_TAAGAATCGCAGGGATAAGG
  • BKK31540 ([gene|19BA45BD691BBA4B23C4741C63DB729AA5D30FDA|nupN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATATAACCCCCCAGAA, downstream forward: _UP4_TAAGAATCGCAGGGATAAGG
  • References

  • 12618455,18763711,20935095,21699902,21926227,16418175