SubtiBank SubtiBank
lipM
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

lipM

octanoyltransferase
locus
BSU_24530
pI
5.93
mw
32.09 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
function
biosynthesis of lipoic acid
product
octanoyltransferase
essential
no
ec
2.3.1.181
synonyms
yqhM

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.7|Biosynthesis and scavenging of lipoic acid]
  • Gene

    Coordinates
    2,543,968 2,544,804

    The protein

    Catalyzed reaction/ biological activity

  • transfers the octanoyl moiety from octanoyl-acyl carrier protein to the lipoyl domains of the 2-oxoacid dehydrogenases via a thioester-linked octanoyl-LipM intermediate [Pubmed|20882995]
  • L-lysyl-[protein] + octanoyl-[ACP] --> H+ + holo-[ACP] + N6-octanoyl-L-lysyl-[protein] (according to UniProt)
  • Protein family

  • octanoyltransferase LipM family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|BPL/LPL catalytic domain] (aa 33-248) (according to UniProt)
  • Structure

  • [PDB|3A7A] (from ''E. coli'', 25% identity) [Pubmed|20089862]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|19CEB80CF637F1FED7C493EF743B4BFA632C8D44|lipM]-[gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C469 (yqhM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2467 NBRP B. subtilis, Japan]
  • BKE24530 ([gene|19CEB80CF637F1FED7C493EF743B4BFA632C8D44|lipM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAGACCTTCCTTAC, downstream forward: _UP4_TAAACAGGGCTTTTGACCCG
  • BKK24530 ([gene|19CEB80CF637F1FED7C493EF743B4BFA632C8D44|lipM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTAAGACCTTCCTTAC, downstream forward: _UP4_TAAACAGGGCTTTTGACCCG
  • References

    Reviews

  • 27074917
  • Original publications

  • 20882995,20089862