SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


DNA uptake, major component of the pseudopilus
10.71 kDa
protein length
gene length
297 bp Sequence Blast
genetic competence
major pseudopilin

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,557,673 2,557,969

    Phenotypes of a mutant

  • knockout has complete loss of transformation competence [Pubmed|1968455]
  • The protein

    Protein family

  • comGC family (single member, according to UniProt)
  • [SW|Localization]

  • cell surface [Pubmed|9723928]
  • localizes to the cell membrane and the cytoplasm [Pubmed|21278288]
  • localizes to one single cell pole in the majority of the cells [Pubmed|21278288]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507524], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|26735940], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|8196543], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|26735940]
  • additional information

  • the ''[SW|comGA]-[SW|comGB]-[SW|comGC]-[SW|comGD]-[SW|comGE]-[SW|comGF]-[SW|comGG]-[protein|search|spoIIIL]'' operon requires [SW|NusA] for expression [ Reference]
  • view in new tab

    Biological materials


  • BKE24710 ([gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCTCATTCATCAGCCTCT, downstream forward: _UP4_ATCATCACCGGCGGAGAAGT
  • BKK24710 ([gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCTCATTCATCAGCCTCT, downstream forward: _UP4_ATCATCACCGGCGGAGAAGT
  • BP914 (([gene|41DFEF8A6BC7E34A6681C26D92F2B08DC120A957|comGA]-[gene|EA1C841FC77A1994A85E2E0C0A554482C3EC9323|comGB]-[gene|19D76B80386F825109C5FB4A34881D5D20F366DB|comGC]-[gene|D323AEF5AFB4FD2A074ABAB76A39BE26A4C6436F|comGD]-[gene|FF4DB7FDCEB440064E11E65CB0DBFB93FC785CF0|comGE]-[gene|DD266DC0D78B5C5E82EED7CC7F55D0CF8FB4BF7A|comGF]-[gene|89442BFDFBFF264D0C7F12DEA6F8130C55D1F3F8|comGG])::phleo), available in [SW|Fabian Commichau]'s lab
  • References


  • 15083159,31950915
  • Original publications

  • 11744713,11814663,9422590,16751195,9723928,1968455,7783624,21278288,12107147,2507524,8196543