SubtiBank SubtiBank
moaA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

moaA

molybdopterin precursor biosynthesis
locus
BSU_36700
pI
9.28
mw
38.39 kDa
protein length
341 aa Sequence Blast
gene length
1026 bp Sequence Blast
function
nitrate respiration
product
unknown
essential
no
synonyms
narA,narAB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.10|Biosynthesis of molybdopterin]
  • Gene

    Coordinates
    3,772,325 3,773,350

    The protein

    Catalyzed reaction/ biological activity

  • involved in the first step of molybdenum cofactor biosynthesis (together with [protein|4A8D74B83E20FA138ED66F0D8FD456B69B740D92|YdiG])
  • AH2 + GTP + S-adenosyl-L-methionine --> (8S)-3',8-cyclo-7,8-dihydroguanosine 5'-triphosphate + 5'-deoxyadenosine + A + H+ + L-methionine (according to UniProt)
  • Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • S-adenosyl methionine (according to UniProt)
  • Structure

  • [PDB|1TV7] (from Staphylococcus aureus, 49% identity) [pubmed|15317939]
  • Expression and Regulation

    Operons

    genes
    [gene|095DAEED5F22A3BC46614C16CC907A2DB9E32C6E|fdhD]-[gene|19EB8E7CBC0E8D7A6429ADFFF93D1F71EFE3FF11|moaA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE36700 ([gene|19EB8E7CBC0E8D7A6429ADFFF93D1F71EFE3FF11|moaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTAATCATAGCTACAGCCC, downstream forward: _UP4_TAATTTGAAGTCAAAAGCTT
  • BKK36700 ([gene|19EB8E7CBC0E8D7A6429ADFFF93D1F71EFE3FF11|moaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTAATCATAGCTACAGCCC, downstream forward: _UP4_TAATTTGAAGTCAAAAGCTT
  • References

    Reviews

  • 23539623,25268953
  • Original publications

  • 7860592,9352926,15317939