SubtiBank SubtiBank
glsA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

glsA

glutaminase, low affinity for glutamine
locus
BSU_02430
pI
5.32
mw
36.03 kDa
protein length
327 aa Sequence Blast
gene length
984 bp Sequence Blast
function
glutamine degradation
product
glutaminase
essential
no
ec
3.5.1.2
synonyms
ybgJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.1|Utilization of glutamine/ glutamate]
  • Gene

    Coordinates
    264,191 265,174

    The protein

    Catalyzed reaction/ biological activity

  • H2O + L-glutamine --> L-glutamate + NH4+ (according to UniProt)
  • Protein family

  • glutaminase family (with [protein|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|YlaM], according to UniProt)
  • Paralogous protein(s)

  • [protein|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|YlaM]
  • Structure

  • [PDB|3BRM] [PDB|1MKI][Pubmed|18459799]
  • Expression and Regulation

    Operons

    genes
    [gene|1A415DC85354373EA4866733C3AE43F510BD3C56|glsA]-[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]
    description
    [Pubmed|15995196]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15995196], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|GlnL]: activation, [Pubmed|15995196], in [regulon|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|GlnL regulon]
  • regulation

  • induced in the presence of glutamine ([protein|search|GlnL]) [Pubmed|15995196]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B943 (ybgJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1942 NBRP B. subtilis, Japan]
  • BKE02430 ([gene|1A415DC85354373EA4866733C3AE43F510BD3C56|glsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAATTCCTCCTCACTG, downstream forward: _UP4_TAAACATGAAAAAAGAGGTG
  • BKK02430 ([gene|1A415DC85354373EA4866733C3AE43F510BD3C56|glsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAATTCCTCCTCACTG, downstream forward: _UP4_TAAACATGAAAAAAGAGGTG
  • References

  • 15995196,18459799