SubtiBank SubtiBank
ycbG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycbG

transcription regulator of the glucarate/galactarate utilization operon ([SW|GntR family])
locus
BSU_02500
pI
5.99
mw
26.43 kDa
protein length
233 aa Sequence Blast
gene length
702 bp Sequence Blast
function
regulation of glucarate/galactarate utilization
product
transcription regulator ([SW|GntR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.14|Utilization of glucarate/galactarate]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    273,237 273,938

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • [SW|Domains]

  • [SW|HTH gntR-type domain] (aa 16–84) (according to UniProt)
  • Structure

  • [PDB|2DI3] (from Corynebacterium glutamicum, corresponds to aa 20 ... 178, 32.7% identity) [pubmed|18988622]
  • Expression and Regulation

    Operons

    genes
    [gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]-[gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]-[gene|9C4932DA4DEF99263E57871A99684E3DAD93E1EC|ycbE]-[gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]-[gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]-[gene|BA556E144975921DFDD598B0A7480C65176F0F14|ycbH]-[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]
    description
    [Pubmed|12044674]

    regulatory mechanism

  • [protein|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG]: repression, [Pubmed|12044674], in [regulon|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C030 (ycbG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2028 NBRP B. subtilis, Japan]
  • BKE02500 ([gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAACAACTCTCCCTTCA, downstream forward: _UP4_TAATGGTGAGCAACCGCAGT
  • BKK02500 ([gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAACAACTCTCCCTTCA, downstream forward: _UP4_TAATGGTGAGCAACCGCAGT
  • References

  • 12044674,23504016,18988622