SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcription regulator of the glucarate/galactarate utilization operon ([SW|GntR family])
26.43 kDa
protein length
233 aa Sequence Blast
gene length
702 bp Sequence Blast
regulation of glucarate/galactarate utilization
transcription regulator ([SW|GntR family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glucarate/galactarate]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    273,237 273,938

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • Expression and Regulation



    regulatory mechanism

  • [protein|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG]: repression, [Pubmed|12044674], in [regulon|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
  • view in new tab

    Biological materials


  • MGNA-C030 (ycbG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02500 ([gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAACAACTCTCCCTTCA, downstream forward: _UP4_TAATGGTGAGCAACCGCAGT
  • BKK02500 ([gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAACAACTCTCCCTTCA, downstream forward: _UP4_TAATGGTGAGCAACCGCAGT
  • References

  • 12044674,23504016