SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


sublancin 168 is post-translationally modified antimicrobial precursor peptide from the glycocin class
5.85 kDa
protein length
gene length
171 bp Sequence Blast
exported antimicrobial peptide
sublancin 168 antimicrobial precursor peptide

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW|Toxins, antitoxins and immunity/ Additional genes]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,269,521 2,269,691

    The protein


  • contains a glucose attached to a cysteine residue, glycosylation is essential for its antimicrobial activity [Pubmed|21196935]
  • Structure

  • [PDB|2MIJ] [Pubmed|24405370]
  • [SW|Localization]

  • secreted [pubmed|21196935]
  • Expression and Regulation



    regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: activation, [Pubmed|20817675,19465659], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|27902860,15743949], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[SW|DnaA] [Pubmed|27902860,15743949]
  • expression starts in the stationary phase [pubmed|30808982]
  • expression is heterogeneous in the population, this is mediated by [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB], [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok], and [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] [pubmed|30808982]
  • additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • the amount of the mRNA is substantially decreased upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab



  • repressed by [protein|search|Rok]-[SW|DnaA] [Pubmed|27902860,15743949]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • GP1563 (aphA3), available in [SW|Jörg Stülke]'s labb
  • GP1565 (''[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]-[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]'', aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE21480 ([gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTAAAACCTCCCCAT, downstream forward: _UP4_TAAAACATTTGTAGAGGGAA
  • BKK21480 ([gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTAAAACCTCCCCAT, downstream forward: _UP4_TAAAACATTTGTAGAGGGAA
  • References

  • 27902860,12884008,9722542,15743949,17720793,16306698,19465659,21196935,24405370,22400495,20817675,21910430,25879813,26282429,26339632,29112373,30808982