SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


sublancin 168 is post-translationally modified antimicrobial precursor peptide from the glycocin class
5.85 kDa
protein length
gene length
171 bp Sequence Blast
exported antimicrobial peptide
sublancin 168 antimicrobial precursor peptide

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,269,521 2,269,691

    The protein


  • contains a glucose attached to a cysteine residue, glycosylation is essential for its antimicrobial activity [Pubmed|21196935]
  • Structure

  • [PDB|2MIJ] [Pubmed|24405370]
  • [SW|Localization]

  • secreted [pubmed|21196935]
  • Expression and Regulation



    regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: activation, [Pubmed|20817675,19465659], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] [Pubmed|27902860,15743949], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]-[SW|DnaA] [Pubmed|27902860,15743949]
  • expression starts in the stationary phase [pubmed|30808982]
  • expression is heterogeneous in the population, this is mediated by [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB], [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok], and [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] [pubmed|30808982]
  • additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • the amount of the mRNA is substantially decreased upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab



  • repressed by [protein|search|Rok]-[SW|DnaA] [Pubmed|27902860,15743949]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • GP1563 (aphA3), available in [SW|Jörg Stülke]'s labb
  • GP1565 (''[gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]-[gene|5599DC922B2B70364603FB5566314D808D82DC08|sunI]'', aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE21480 ([gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTAAAACCTCCCCAT, downstream forward: _UP4_TAAAACATTTGTAGAGGGAA
  • BKK21480 ([gene|1A6D90298D039FFFD977B2534952BA5E32B3530F|sunA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTAAAACCTCCCCAT, downstream forward: _UP4_TAAAACATTTGTAGAGGGAA
  • References

  • 27902860,12884008,9722542,15743949,17720793,16306698,19465659,21196935,24405370,22400495,20817675,21910430,25879813,26282429,26339632,29112373,30808982