SubtiBank SubtiBank
purE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

purE

phosphoribosylaminoimidazole carboxylase (ATP-dependent)
locus
BSU_06420
pI
5.20
mw
17.03 kDa
protein length
162 aa Sequence Blast
gene length
489 bp Sequence Blast
function
purine biosynthesis
product
phosphoribosylaminoimidazole carboxylase (ATP-dependent)
essential
no
ec
4.1.1.21
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    Coordinates
    698,612 699,100

    The protein

    Catalyzed reaction/ biological activity

  • 5-carboxyamino-1-(5-phospho-D-ribosyl)imidazole + H+ --> 5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxylate (according to UniProt)
  • Protein family

  • AIR carboxylase family ( single member, according to UniProt)
  • Structure

  • [PDB|1O4V] (from ''Thermotoga maritima'', 53% identity, 64% similarity) [Pubmed|15048837]
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE06420 ([gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTTCCCCACCTTCT, downstream forward: _UP4_ACAGTGTTAGAAAGCAGTGA
  • BKK06420 ([gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGTTCCCCACCTTCT, downstream forward: _UP4_ACAGTGTTAGAAAGCAGTGA
  • References

  • 12787499,3036807,12923093,7638212