SubtiBank SubtiBank
yvbG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvbG

unknown
locus
BSU_33850
pI
9.81
mw
22.44 kDa
protein length
211 aa Sequence Blast
gene length
636 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,471,841 3,472,476

    The protein

    Protein family

  • UPF0056 (marC) family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1AA1FDF5EE7040A349522A927D8F6C1F691B3CF9|yvbG]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A459 (yvbG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/459 NBRP B. subtilis, Japan]
  • BKE33850 ([gene|1AA1FDF5EE7040A349522A927D8F6C1F691B3CF9|yvbG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACCTCCTTGTTGATA, downstream forward: _UP4_TCATGATGCAAAAAGCAGCT
  • BKK33850 ([gene|1AA1FDF5EE7040A349522A927D8F6C1F691B3CF9|yvbG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACCTCCTTGTTGATA, downstream forward: _UP4_TCATGATGCAAAAAGCAGCT
  • References

  • 26577401