SubtiBank SubtiBank
ycgS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycgS

similar to aromatic hydrocarbon catabolism
locus
BSU_03260
pI
8.23
mw
31.59 kDa
protein length
284 aa Sequence Blast
gene length
855 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    351,842 352,696

    The protein

    Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 25-123) (according to UniProt)
  • Structure

  • [PDB|4Y7D] (from Nakamurella multipartita, 25% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|1AA67AD33622538F7BAD64B54FAE6FD8103BF9BE|ycgS]-[gene|51EF3C9A48FA7367576656F5E79D38D1B56BF6A5|ycgR]-[gene|99C8AA68035A9580FA3145ABE66F4DD63CDD6AE8|ycgQ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B997 (ycgS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1996 NBRP B. subtilis, Japan]
  • BKE03260 ([gene|1AA67AD33622538F7BAD64B54FAE6FD8103BF9BE|ycgS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTCACCCAATTGG, downstream forward: _UP4_TAACCAAAGTGAAACGATCC
  • BKK03260 ([gene|1AA67AD33622538F7BAD64B54FAE6FD8103BF9BE|ycgS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTCACCCAATTGG, downstream forward: _UP4_TAACCAAAGTGAAACGATCC