SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glycine betaine-aldehyde dehydrogenase, glycine betaine synthesis
53.50 kDa
protein length
490 aa Sequence Blast
gene length
1473 bp Sequence Blast
glycine betaine-aldehyde dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of glycine betaine]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    3,185,092 3,186,564

    The protein

    Catalyzed reaction/ biological activity

  • betaine aldehyde + H2O + NAD+ --> betaine + 2 H+ + NADH (according to UniProt)
  • Protein family

  • [SW|aldehyde dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|2042F691CB37B1BAFE2CF3906A9F7F47457C3995|PutC], [protein|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|YcbD], [protein|67A72A0EABCD807C25D8EAC61C251142B45C174E|DhaS], [protein|69838717DC6BB27864D88C282BF5BC7CC558BFD7|RocA], [protein|762718A15E5256261D79DF60F9106AF0CE2D60C6|IolA], [protein|99F1FAF28FB4817D94E84BD5288FA33124558933|YwdH], [protein|A0BEB92D54799956A4ADE106A1388E5710141069|GabD], [protein|EF0AAAF5BAE8E1F54FCA296643F7B9E3CE257B1D|YfmT], [protein|F3341F205CB939498109D2A54DE842065C488DD5|AldX], [protein|F9CF067A2A8E3B2BACC6A51A0E87E84640349980|AldY]
  • Structure

  • [PDB|4QTO] (from ''Staphylococcus aureus'', 67% identity, 87% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8752328], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR]: repression, (transcriptional roadblock) [Pubmed|32849357,22408163], in [regulon|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR regulon]
  • regulation

  • induced by choline ([protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR]) [Pubmed|22408163,8752328]
  • view in new tab

    Biological materials


  • 1A1056 ( ''gbsA''::''kan''), [Pubmed|21296969], available at [ BGSC]
  • BKE31060 ([gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAGCCTCCTTGACGT, downstream forward: _UP4_AATTCATAAGAGGGGGAGAT
  • BKK31060 ([gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATAAGCCTCCTTGACGT, downstream forward: _UP4_AATTCATAAGAGGGGGAGAT
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [ homepage]
  • References

  • 9297465,8752328,21296969,22408163,29159878,32849357