SubtiBank SubtiBank
ydfJ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydfJ

similar to antibiotic transport-associated protein
locus
BSU_05430
pI
5.18
mw
76.85 kDa
protein length
724 aa Sequence Blast
gene length
2175 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    589,717 591,891

    The protein

    Protein family

  • resistance-nodulation-cell division (RND) (TC 2.A.6) family (with [protein|1632474628BEA113F297897D152276A1AB73BAE8|YdgH] and [protein|AAC32230E3E585932A876737131C3E2C15168B2A|SwrC], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|EFEAF09E4449A022A7323450FDED9458426A0080|YdfI]: activation, [Pubmed|15941986], in [regulon|EFEAF09E4449A022A7323450FDED9458426A0080|YdfI regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C149 (ydfJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2147 NBRP B. subtilis, Japan]
  • BKE05430 ([gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAATCTCCTTTCAAC, downstream forward: _UP4_TAATAGAAAAAGCAGATCTT
  • BKK05430 ([gene|1B61298ECA583D2112AA56A88358E8A9A55D2C9D|ydfJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAATCTCCTTTCAAC, downstream forward: _UP4_TAATAGAAAAAGCAGATCTT
  • References

  • 15941986