SubtiBank SubtiBank
ycnI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycnI

unknown
locus
BSU_03940
pI
4.83
mw
21.97 kDa
protein length
204 aa Sequence Blast
gene length
615 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    446,174 446,788

    The protein

    Structure

  • [PDB|3ESM] (from Nocardia farcinica, corresponds to aa 25 ... 137, 34.5% identity)
  • [SW|Localization]

  • cell membrane [pubmed|30602489]
  • Expression and Regulation

    Operons

    genes
    [gene|98D807FBB847BF731B5C236557C8F70347279CE0|ycnK]-[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]-[gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]
    description
    [Pubmed|22904286,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22904286], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|98D807FBB847BF731B5C236557C8F70347279CE0|YcnK]: repression, [Pubmed|22904286,19168619], in [regulon|98D807FBB847BF731B5C236557C8F70347279CE0|YcnK regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by copper limitation ([protein|search|YcnK]) [Pubmed|22904286,19168619]
  • view in new tab

    Biological materials

    Mutant

  • BKE03940 ([gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTAAACACTCCTTAAT, downstream forward: _UP4_TAATAAAGAAAGCGATCCAG
  • BKK03940 ([gene|1B7F59F954A1F20F75F5D4953F84CE58171741DE|ycnI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGTAAACACTCCTTAAT, downstream forward: _UP4_TAATAAAGAAAGCGATCCAG
  • References

  • 22904286,22383849,30602489