SubtiBank SubtiBank
dltB
The papers of the month are back! Check them out! Link here

dltB

D-alanine transfer from [protein|862D977CF1E185597329A1EF0915485F72482A03|DltC] to undecaprenol-phosphate, alanylation of teichoic acid provides some resistance against positively charged antimicrobial peptides
locus
BSU38510
pI
9.94
mw
46.58 kDa
protein length
395 aa Sequence Blast
gene length
1185 bp Sequence Blast
function
biosynthesis of teichoic acid
product
D-alanine transfer from [protein|862D977CF1E185597329A1EF0915485F72482A03|DltC] to undecaprenol-phosphate
essential
no
synonyms
ipa-4r

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.4|Biosynthesis of teichoic acid]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.3|Biosynthesis of teichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,953,783 → 3,954,970

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Protein family

  • membrane-bound acyltransferase family (according to Swiss-Prot)
  • Structure

  • [PDB|6BUI] (from Streptococcus thermophilus) [pubmed|30283133]
  • [PDB|6BUG] ([protein|search|DtlB]-[protein|862D977CF1E185597329A1EF0915485F72482A03|DltC] complex from Streptococcus thermophilus) [pubmed|30283133]
  • [PDB|6BUH] ([protein|search|DtlB]-[protein|862D977CF1E185597329A1EF0915485F72482A03|DltC] complex from Streptococcus thermophilus) [pubmed|30283133]
  • [SW|Localization]

  • cytoplasma membrane [Pubmed|30283133]
  • Expression and Regulation

    Operons

    genes
    [gene|459ED28A98F4EC7E8A9016C742DC8EB5C26B5E65|ywzH]-[gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA]-[gene|1B9BAEBE029BE9D4AD7E49C38B1E6DB5E8F4D4D3|dltB]-[gene|862D977CF1E185597329A1EF0915485F72482A03|dltC]-[gene|D178EC8A1FF22C99C437E01FC4843C5176564992|dltD]-[gene|2FB3F09DA60A40212FE20217A64DAE714AB807CF|dltE]
    description
    [Pubmed|29794222]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|7797557], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|14762009], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, [Pubmed|21926231], in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulatory mechanism

  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|7797557], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • expression is reduced in a [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV] mutant [Pubmed|21926231]
  • the mRNA is processed between [gene|459ED28A98F4EC7E8A9016C742DC8EB5C26B5E65|ywzH] and [gene|795CD64B65D7CBF26E5F706C7617196CC6FCF864|dltA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE38510 (Δ[gene|1B9BAEBE029BE9D4AD7E49C38B1E6DB5E8F4D4D3|dltB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTCATACAAGAACCTCTTC, downstream forward: _UP4_CACCATTAAAGGAGATTAGA
  • BKK38510 (Δ[gene|1B9BAEBE029BE9D4AD7E49C38B1E6DB5E8F4D4D3|dltB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGTCATACAAGAACCTCTTC, downstream forward: _UP4_CACCATTAAAGGAGATTAGA
  • References

    Reviews

  • 24819367
  • Original publications

  • 14762009,12028417,7797557,18763711,23980836,21856855,21926231,30283133