SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


protein arginine phosphatase
16.64 kDa
protein length
150 aa Sequence Blast
gene length
453 bp Sequence Blast
dephosphorylation of [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|McsB]
protein arginine phosphatase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • Gene

    3,791,805 3,792,257

    Phenotypes of a mutant

  • impaired spore germination [pubmed|31221751]
  • The protein

    Catalyzed reaction/ biological activity

  • Protein arginine phosphate + H2O --> protein arginine + phosphate [Pubmed|22517742]
  • Protein family

  • low molecular weight phosphotyrosine protein phosphatase family (with [protein|DB3527FB78D0B7C144D1699D665788184F19AFE0|ArsC] and [protein|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|YfkJ], according to UniProt)
  • Paralogous protein(s)

  • [protein|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|YfkJ]
  • Effectors of protein activity

  • activity is inhibited by oxidative stress [Pubmed|27524296]
  • Structure

  • [PDB|1ZGG]
  • [SW|Localization]

  • weak oligomerization, results in inactivation of YwlE [Pubmed|19678837]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-A186 (ywlE::erm), available at the [ NBRP B. subtilis, Japan]
  • ''ywlE::aphA3'' available from [SW|Ulf Gerth]'s lab
  • ''ywlE::tet'' available from [SW|Ulf Gerth]'s lab
  • ''ywlE::spec'' available from [SW|Ulf Gerth]'s lab
  • GP1458 (''ywlE''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • GP1459 (''ywlE''::''tet''), available in [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labs [Pubmed|25610436]
  • BKE36930 ([gene|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGTCACCCCTTATT, downstream forward: _UP4_TAAGTTGTCAGAAAATCTGC
  • BKK36930 ([gene|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGTCACCCCTTATT, downstream forward: _UP4_TAAGTTGTCAGAAAATCTGC
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in [SW|Ulf Gerth]'s lab
  • expression of native ''ywlE'' in ''B. subtilis'': pBP183 (in [SW|pBQ200]), available in [SW|Fabian Commichau]'s lab
  • Antibody

  • available in [SW|Ulf Gerth]'s lab
  • labs

  • [SW|Ulf Gerth], Greifswald, Germany
  • [SW|Fabian Commichau] Göttingen, Germany [ homepage]
  • References


  • 27541193,28748186
  • Original Publications

  • 16452434,15866923,15995210,19678837,21622759,20852588,22517742,23770242,23838530,24263382,24825175,25610436,27524296,31221751