SubtiBank SubtiBank
ywlE
The papers of the month are back! Check them out! Link here

ywlE

protein arginine phosphatase
locus
BSU36930
pI
6.68
mw
16.64 kDa
protein length
150 aa Sequence Blast
gene length
450 bp Sequence Blast
function
dephosphorylation of McsB
product
protein arginine phosphatase
essential
no
ec
3.1.3.48
synonyms
ipc-31d

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • Gene

    Coordinates
    3,791,805 → 3,792,257

    The protein

    Catalyzed reaction/ biological activity

  • Protein arginine phosphate + H2O = protein arginine + phosphate [Pubmed|22517742]
  • Paralogous protein(s)

  • [protein|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|YfkJ]
  • Effectors of protein activity

  • activity is inhibited by oxidative stress [Pubmed|27524296]
  • Structure

  • [PDB|1ZGG]
  • [SW|Localization]

  • weak oligomerization, results in inactivation of YwlE [Pubmed|19678837]
  • Biological materials

    Mutant

  • MGNA-A186 (ywlE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/186 NBRP B. subtilis, Japan]
  • ''ywlE::aphA3'' available from [SW|Ulf Gerth]'s lab
  • ''ywlE::tet'' available from [SW|Ulf Gerth]'s lab
  • ''ywlE::spec'' available from [SW|Ulf Gerth]'s lab
  • GP1458 (''ywlE''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • GP1459 (''ywlE''::''tet''), available in [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labs [Pubmed|25610436]
  • BKE36930 (Δ[gene|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGTCACCCCTTATT, downstream forward: _UP4_TAAGTTGTCAGAAAATCTGC
  • BKK36930 (Δ[gene|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGTCACCCCTTATT, downstream forward: _UP4_TAAGTTGTCAGAAAATCTGC
  • Expression vector

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in [SW|Ulf Gerth]'s lab
  • expression of native ''ywlE'' in ''B. subtilis'': pBP183 (in [SW|pBQ200]), available in [SW|Fabian Commichau]'s lab
  • Antibody

  • available in [SW|Ulf Gerth]'s lab
  • Labs working on this gene/protein

  • [SW|Ulf Gerth], Greifswald, Germany
  • [SW|Fabian Commichau] Göttingen, Germany
  • References

    Reviews

  • 27541193,28748186
  • Original Publications

  • 16452434,15866923,15995210,19678837,21622759,20852588,22517742,23770242,23838530,24263382,24825175,25610436,27524296