SubtiBank SubtiBank
ywlE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywlE

protein arginine phosphatase
locus
BSU_36930
pI
6.68
mw
16.64 kDa
protein length
150 aa Sequence Blast
gene length
453 bp Sequence Blast
function
dephosphorylation of [protein|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|McsB]
product
protein arginine phosphatase
essential
no
ec
3.1.3.48
synonyms
ipc-31d

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • Gene

    Coordinates
    3,791,805 3,792,257

    Phenotypes of a mutant

  • impaired spore germination [pubmed|31221751]
  • The protein

    Catalyzed reaction/ biological activity

  • Protein arginine phosphate + H2O --> protein arginine + phosphate [Pubmed|22517742]
  • Protein family

  • low molecular weight phosphotyrosine protein phosphatase family (with [protein|DB3527FB78D0B7C144D1699D665788184F19AFE0|ArsC] and [protein|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|YfkJ], according to UniProt)
  • Paralogous protein(s)

  • [protein|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|YfkJ]
  • Effectors of protein activity

  • activity is inhibited by oxidative stress [Pubmed|27524296]
  • Structure

  • [PDB|1ZGG]
  • [SW|Localization]

  • weak oligomerization, results in inactivation of YwlE [Pubmed|19678837]
  • Expression and Regulation

    Operons

    genes
    [gene|19829F6D993188BE854F0F61CB93777AD04CF754|ywlD]-[gene|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]-[gene|91827FEC70F5EEB8B072D06ABA05C19FC54D5F71|ywlF]-[gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]-[gene|91827FEC70F5EEB8B072D06ABA05C19FC54D5F71|ywlF]-[gene|41407DE15D91959DA92799623F1364811C170F35|ywlG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A186 (ywlE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/186 NBRP B. subtilis, Japan]
  • ''ywlE::aphA3'' available from [SW|Ulf Gerth]'s lab
  • ''ywlE::tet'' available from [SW|Ulf Gerth]'s lab
  • ''ywlE::spec'' available from [SW|Ulf Gerth]'s lab
  • GP1458 (''ywlE''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • GP1459 (''ywlE''::''tet''), available in [SW|Jörg Stülke]'s and [SW|Fabian Commichau]'s labs [Pubmed|25610436]
  • BKE36930 ([gene|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGTCACCCCTTATT, downstream forward: _UP4_TAAGTTGTCAGAAAATCTGC
  • BKK36930 ([gene|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|ywlE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAGTCACCCCTTATT, downstream forward: _UP4_TAAGTTGTCAGAAAATCTGC
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in [SW|Ulf Gerth]'s lab
  • expression of native ''ywlE'' in ''B. subtilis'': pBP183 (in [SW|pBQ200]), available in [SW|Fabian Commichau]'s lab
  • Antibody

  • available in [SW|Ulf Gerth]'s lab
  • labs

  • [SW|Ulf Gerth], Greifswald, Germany
  • [SW|Fabian Commichau] Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]
  • References

    Reviews

  • 27541193,28748186
  • Original Publications

  • 16452434,15866923,15995210,19678837,21622759,20852588,22517742,23770242,23838530,24263382,24825175,25610436,27524296,31221751,32730774,33101263