SubtiBank SubtiBank
kbl
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

kbl

2-amino-3-ketobutyrate CoA ligase
locus
BSU_17000
pI
6.25
mw
43.12 kDa
protein length
392 aa Sequence Blast
gene length
1179 bp Sequence Blast
function
threonine utilization
product
2-amino-3-ketobutyrate CoA ligase
essential
no
ec
2.3.1.29
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.8|Utilization of threonine/ glycine]
  • Gene

    Coordinates
    1,771,517 1,772,695

    The protein

    Catalyzed reaction/ biological activity

  • H+ + L-alanine + pimeloyl-[ACP] --> 8-amino-7-oxononanoate + CO2 + holo-[ACP] (according to UniProt)
  • Protein family

  • [SW|class-II pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8B6A3E86A88928526D94FDA94B9C81ABF6E9ACFB|BioF]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|1FC4] (from ''Escherichia coli'', 40% identity, 60% similarity) [Pubmed|11318637]
  • Expression and Regulation

    Operons

    genes
    [gene|8E64B62F15B92A2AACD68B913909100AE276D114|tdh]-[gene|1BC05699DEB3A16944FB8305F22976AED75805E8|kbl]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE17000 ([gene|1BC05699DEB3A16944FB8305F22976AED75805E8|kbl]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATCCCCCTTTATG, downstream forward: _UP4_TAACAAGAGGAAGAGTTTAC
  • BKK17000 ([gene|1BC05699DEB3A16944FB8305F22976AED75805E8|kbl]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATCCCCCTTTATG, downstream forward: _UP4_TAACAAGAGGAAGAGTTTAC
  • References

  • 11318637,22960854