SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|ABC transporter], ATP-binding protein, export of the mature [protein|D66B9BFF79ADD8B0F9BFA3892FCF4597264CE9EE|YydF] epipeptide
23.74 kDa
protein length
209 aa Sequence Blast
gene length
630 bp Sequence Blast
control of [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]-[protein|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|LiaS] activity
[SW|ABC transporter], ATP-binding protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Export of peptides]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Control of response regulators/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,124,963 4,125,592

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 1-207) (according to UniProt)
  • Structure

  • [PDB|4HLU] (aa 7- 175, Thermotoga maritima EcfA, 32% identity) [pubmed|23359690]
  • [SW|Localization]

  • membrane associated (via [protein|A4213DE6C9BE29405B0A4C0A969A78EA4C5EB71F|YydJ]) [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17921301], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|17921301], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • regulation

  • activated after transition to stationary phase([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|17921301]
  • view in new tab

    Biological materials


  • MGNA-B808 (yydI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40150 ([gene|1BF1A48CF645249CA9ECBB19C04B059B11D821EF|yydI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACATACTCCTAGGAA, downstream forward: _UP4_TAATAAAACAGTGGGGGCTT
  • BKK40150 ([gene|1BF1A48CF645249CA9ECBB19C04B059B11D821EF|yydI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATACATACTCCTAGGAA, downstream forward: _UP4_TAATAAAACAGTGGGGGCTT
  • References


  • 23106164
  • Original publications

  • 10092453,23199363,17921301,15743949,17921301,21815947,28644475,23359690,32117169