SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional repressor (GntR family) of the gntR-gntK-gntP-gntZ operon
28.13 kDa
protein length
243 aa Sequence Blast
gene length
732 bp Sequence Blast
regulation of gluconate utilization
transcriptional repressor of the gluconate operon

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of gluconate]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    4,113,417 4,114,148

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • [SW|Domains]

  • [SW|HTH gntR-type domain] (aa 17-83) (according to UniProt)
  • Effectors of protein activity

  • gluconate acts as molecular inducer
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3020045], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR]: repression, [Pubmed|3020045], in [regulon|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by gluconate ([protein|search|GntR]) [Pubmed|3020045]
  • view in new tab

    Biological materials


  • BKE40050 ([gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACTCACCTTCCTCAC, downstream forward: _UP4_CTGGCAAAAGGAGCTGAATA
  • BKK40050 ([gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACACTCACCTTCCTCAC, downstream forward: _UP4_CTGGCAAAAGGAGCTGAATA
  • References

  • 8370661,8808939,8288545,7642511,7476858,8596444,3011959,2163901,3037520,2492998,9106211,2419835,2124676,3020045,10746760,8510140,2843515,7476858,3020045,1659648,21106498,22900538,220817675,27829583