SubtiBank SubtiBank
sbp
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

sbp

small basic protein
locus
BSU_15270
pI
10.00
mw
13.17 kDa
protein length
121 aa Sequence Blast
gene length
366 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,595,935 1,596,300

    The protein

    Protein family

  • sbp family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG]-[gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
    description
    [Pubmed|18179421]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, (promoter within [protein|D52FDB5015B10E9B26D7FED5708457890C6EA43D|MurG]) [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8106328], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8320223], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab

    genes
    [gene|D48B7591467C493D2214D37AEA83643FE8C27BC6|murE]-[gene|4D3D4429E1F387BACB0D5A1084AA8DF179A16685|mraY]-[gene|0A9FF5A66F73464A780914A1424979CE753B3D9C|murD]-[gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]-[gene|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG]-[gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
    description
    [Pubmed|1391053]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8320223], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during vegatative growth [Pubmed|1391053]
  • view in new tab

    genes
    [gene|5DE602D97D903D9AE38ED05D5A5F1B3A2DC1D58E|spoVE]-[gene|D52FDB5015B10E9B26D7FED5708457890C6EA43D|murG]-[gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
    description
    [Pubmed|1391053]

    regulation

  • expressed during vegatative growth, then switched off, and again expressed during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab

    genes
    [gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
    description
    [Pubmed|8106328]
    view in new tab

    genes
    [gene|5E11616A51EE2CD1B8D3E33B18483521C504AD1F|murB]-[gene|B66FC02948DABBCE64DE2629D6E33E05647B4EEF|divIB]-[gene|5CDB49209BDCA86E09D6287DFC16B278D9A71379|ylxW]-[gene|081EA0CBCDA7ECDE8D128DD091C132BB194D19EB|ylxX]-[gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]
    description
    [Pubmed|18179421]

    regulation

  • expressed during vegatative growth, then switched off, and again expressed during [SW|sporulation ]in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|1391053]
  • view in new tab

    Biological materials

    Mutant

  • BKE15270 ([gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCACATGACAATTCTCCTCC, downstream forward: _UP4_TAAAAGAGGATATACATAGG
  • BKK15270 ([gene|1C6CADD1808CA84CBC19D623DACF4D398EB43174|sbp]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCACATGACAATTCTCCTCC, downstream forward: _UP4_TAAAAGAGGATATACATAGG
  • References

  • 1391053,8106328,8320223,7590298,18179421