SubtiBank SubtiBank
yoaH
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yoaH

membrane-bound chemotaxis receptor, similar to methyl-accepting chemotaxis protein
locus
BSU_18610
pI
4.66
mw
58.08 kDa
protein length
561 aa Sequence Blast
gene length
1686 bp Sequence Blast
function
control of chemotaxis
product
membrane-bound chemotaxis receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.4|Membrane-bound chemoreceptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,029,429 2,031,114

    The protein

    [SW|Domains]

  • [SW|HAMP domain] (aa 67-120) (according to UniProt)
  • [SW|Methyl-accepting transducer domain] (aa 275-511) (according to UniProt)
  • Structure

  • [PDB|2CH7] (c-terminus, corresponds to aa 240 ... 560 of [protein|1C8E44680D6015EDA8A26DC6C289F8E0E62C54EE|YoaH], 31% identity) [pubmed|16622408]
  • [SW|Localization]

  • cell membrane [Pubmed|21515776]
  • Expression and Regulation

    Operons

    genes
    [gene|1C8E44680D6015EDA8A26DC6C289F8E0E62C54EE|yoaH]
    description
    [Pubmed|15033535]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • additional information

  • in minimal medium, YoaH is present with 460 +/- 150 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A837 (yoaH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/837 NBRP B. subtilis, Japan]
  • BKE18610 ([gene|1C8E44680D6015EDA8A26DC6C289F8E0E62C54EE|yoaH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCGTTTTCCCTTTC, downstream forward: _UP4_TAAACAGGCTACTTACGTGC
  • BKK18610 ([gene|1C8E44680D6015EDA8A26DC6C289F8E0E62C54EE|yoaH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCGTTTTCCCTTTC, downstream forward: _UP4_TAAACAGGCTACTTACGTGC
  • References

  • 15033535,21515776,16622408