SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


single-strand DNA-binding proteinrequired to internalize and to recombine ssDNA with homologous resident duplex
12.35 kDa
protein length
113 aa Sequence Blast
gene length
342 bp Sequence Blast
required for efficient genetic transformation
single-strand DNA-binding protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    3,740,206 3,740,547

    The protein

    Catalyzed reaction/ biological activity

  • binds and protects internalized foreign ssDNA [Pubmed|22373918]
  • RecA-ATP in concert with [protein|FC53216F600994C862F0C0D017C3FA28EB75DCB6|DprA] and [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA] catalyzes DNA strand exchange, with [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB] as an accessory factor [Pubmed|25138221]
  • Paralogous protein(s)

  • [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA]
  • [SW|Domains]

  • SSB domain (aa 1-104) (according to UniProt)
  • Modification

  • phosphorylated on Arg-55 [Pubmed|22517742]
  • phosphorylated on Tyr by [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA], dephosphorylated by [protein|CF73D86DB024575BE8F043A4C3996458F4262E46|PtpZ] [Pubmed|16549871]
  • Effectors of protein activity

  • phosphorylation strongly increases DNA-binding activity [Pubmed|16549871]
  • Structure

  • [PDB|3VDY] (in complex with ssDNA) [Pubmed|22373918]
  • [SW|Localization]

  • localizes to cell poles in competent cells [Pubmed|16009133]
  • localizes to the DNA entry pole during transformation [Pubmed|22373918]
  • transiently localizes to the cell pole, and co-localizes with the DNA uptake machinery [Pubmed|17630974]
  • Expression and Regulation



    regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • expressed at the onset of stationary phase [Pubmed|14762004]
  • view in new tab

    view in new tab

    Biological materials


  • GP3522 (del kan), available in [SW|Jörg Stülke]'s lab
  • MGNA-A591 (ywpH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36310 ([gene|1CDF658441061EA476E27C2E60DEE45C4F45AC15|ssbB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGATTCCTCCTCTCCT, downstream forward: _UP4_TGACACCCCTGCTCCTCCCG
  • BKK36310 ([gene|1CDF658441061EA476E27C2E60DEE45C4F45AC15|ssbB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGATTCCTCCTCTCCT, downstream forward: _UP4_TGACACCCCTGCTCCTCCCG
  • Expression vectors

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
  • References


  • 22933559,31950915
  • Original publications

  • 16009133,17630974,22373918,16549871,14762004,11948146,22383849,22517742,23536821,23779106,25138221,26707201,31876108