SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional activator of the [gene|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA]-[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]-[gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD] operon
78.67 kDa
protein length
694 aa Sequence Blast
gene length
2082 bp Sequence Blast
regulation of mannitol utilization
transcriptional activator, PRD-type

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of mannitol]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|PRD-type regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • Gene

    467,130 → 469,214

    The protein


  • N-terminal DNA-binding domains, two [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI]-regulation domains (PRD1 and PRD2), EIIB (Gat)-like domain, EIIA (Mtl)-like domain
  • Modification

  • phosphorylated on His-342 and/or His-399 by [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|PtsH] [Pubmed|20444094]
  • phosphorylation on His-599 by [protein|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|MtlA] [Pubmed|20444094]
  • phosphorylation on Cys-419 by [protein|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|MtlF] [Pubmed|20444094]
  • Effectors of protein activity

  • activity is stimulated by [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|PtsH]-dependent phosphorylation in PRD2 (mechnism of carbon catabolite repression) [Pubmed|20444094]
  • activity is inhibited by [protein|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|MtlF]-dependent phosphorylation in the EIIB(Gat)-like domain on Cys-419 (this prevents activity in the absence of mannitol and allows induction in presence of mannitol) [Pubmed|20444094]
  • [SW|Localization]

  • upon interaction with non-phosphorylated [protein|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|MtlA], the active [protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR] localizes to the membrane [Pubmed|23279188]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22014119], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|22900538]
  • view in new tab

    Biological materials


  • BKE04160 (Δ[gene|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGACCTCCTAGC, downstream forward: _UP4_TAAACCTGCATGGCACACGT
  • BKK04160 (Δ[gene|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGACCTCCTAGC, downstream forward: _UP4_TAAACCTGCATGGCACACGT
  • References


  • 23318733,9663674
  • Original publications

  • 12897001,20444094,10627040,10702268,9988713,23279188,22900538,22014119,26159071