SubtiBank SubtiBank
ptb
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ptb

phosphate butyryltransferase
locus
BSU_24090
pI
7.94
mw
31.62 kDa
protein length
299 aa Sequence Blast
gene length
900 bp Sequence Blast
function
utilization of branched-chain keto acids
product
phosphate butyryltransferase
essential
no
ec
2.3.1.19
synonyms
yqiS,bkd

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • Gene

    Coordinates
    2,503,765 2,504,664

    The protein

    Catalyzed reaction/ biological activity

  • butanoyl-CoA + phosphate --> butanoyl phosphate + CoA (according to UniProt)
  • Protein family

  • phosphate acetyltransferase and butyryltransferase family (with [protein|3E343C05EE6FF04D5A54066E19DC6576784E09E7|Pta], according to UniProt)
  • Structure

  • [PDB|1YCO] (from ''Enterococcus faecalis v583'', 36% identity, 56% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|ptb]-[gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd]-[gene|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|buk]-[gene|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|lpdV]-[gene|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA]-[gene|A024921961A786294199EA12E04456C890ED8D8C|bkdAB]-[gene|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB]
    description
    [Pubmed|12823818]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|10094682], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|4CEBD81F485DD0B660E297FFC34A0F5270652184|BkdR]: activation, [Pubmed|10094682], in [regulon|4CEBD81F485DD0B660E297FFC34A0F5270652184|BkdR regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|10094682], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • induced in the presence of isoleucine or valine ([protein|search|BkdR]) [Pubmed|10094682]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C417 (yqiS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2415 NBRP B. subtilis, Japan]
  • BKE24090 ([gene|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|ptb]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTACCACCTTTCTT, downstream forward: _UP4_TACACACATTAGGAGGAACG
  • BKK24090 ([gene|1CFF7202AC6078B6BAD1253F77FD4FE227C046DB|ptb]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTACCACCTTTCTT, downstream forward: _UP4_TACACACATTAGGAGGAACG
  • References

  • 12427936,15241682,12823818,10094682,28165735