SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional activator of the [gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]-[gene|CAE38D8F25A5EC6AC8045E40072E6FEC632045FA|levE]-[gene|8ABA3735067C7AA433E09F219EE7239196377A95|levF]-[gene|F23B951F60A6A669D5BD86836906E0F4AD7A0C1B|levG]-[gene|search|sacC ]operon
105.99 kDa
protein length
938 aa Sequence Blast
gene length
2814 bp Sequence Blast
regulation of levan and fructose utilization
transcriptional activator, PRD-type (for [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-dependent promoter)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of fructose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|PRD-type regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    2,763,025 → 2,765,832

    The protein

    Catalyzed reaction/ biological activity

  • binding to the upstream activating sequence in front of the [gene|75C568C8F6912AC064B8B435975D52510D25466A|levD] gene results in activation of transcription of the [gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]-[gene|CAE38D8F25A5EC6AC8045E40072E6FEC632045FA|levE]-[gene|8ABA3735067C7AA433E09F219EE7239196377A95|levF]-[gene|F23B951F60A6A669D5BD86836906E0F4AD7A0C1B|levG]-[gene|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC] operon, bining occurs in the presence of fructose
  • Protein family

  • [SW|Transcription factors activating transcription at SigL-dependent promoters]
  • Modification

  • phosphorylation (His503, His582, His866) (according to Swiss-Prot)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE27080 (Δ[gene|1D2043CC0D8CF64142F0A5993A936C5A196726D4|levR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTCTATCATCCTTTGTC, downstream forward: _UP4_TAAAAACAGTTTTTTCATAT
  • BKK27080 (Δ[gene|1D2043CC0D8CF64142F0A5993A936C5A196726D4|levR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTCTATCATCCTTTGTC, downstream forward: _UP4_TAAAAACAGTTTTTTCATAT
  • References

  • 1900939,7592487,7592486,8057358,9033408,21906631,9622354